Artikelilmiahs
Menampilkan 19.281-19.300 dari 50.080 item.
| # | Idartikelilmiah | NIM | Judul Artikel | Abstrak (Bhs. Indonesia) | Abtrak (Bhs. Inggris) | |
|---|---|---|---|---|---|---|
| 19281 | 22523 | H1L014038 | SISTEM PENDUKUNG KEPUTUSAN UNTUK SELEKSI ANGGOTA ORGANISASI MAHASISWA DENGAN METODE FUZZY DATABASE MODEL TAHANI BERBASIS WEB (Studi Kasus Badan Eksekutif Mahasiswa Universitas Jenderal Soedirman) | ABSTRAK SISTEM PENDUKUNG KEPUTUSAN UNTUK SELEKSI ANGGOTA ORGANISASI MAHASISWA DENGAN METODE FUZZY DATABASE MODEL TAHANI BERBASIS WEB (Studi Kasus Badan Eksekutif Mahasiswa Universitas Jenderal Soedirman) Reyhan Dary Faturrahman Organisasi merupakan wadah bagi seseorang untuk mendapatkan pengalaman dan soft skill, berbagai bentuk organisasi banyak ditemui didunia perkuliahan berupa BEM, DLM, dan UKM. Sehingga banyak para mahasiswa yang tertarik untuk mendaftar salah satu organisasi yang ada di kampus sesuai dengan minat dan bakatnya sendiri. Untuk memudahkan seleksi anggota organisasi mahasiswa inilah maka dibuatlah suatu sistem pendukung keputusan. Dalam penelitian ini dibangun sebuah sistem pendukung keputusan.agar memudahkan seleksi anggota organisasi mahasiswa dengan metode fuzzy database model tahani, sistem ini akan melakukan seleksi berdasarkan variabel yang sudah ditentukan sehingga menciptakan suatu kemudahan dalam pengambilan keputusan untuk seleksi anggota organisasi. Sistem ini dibangun dengan bahasa pemrograman PHP dan basis data MySQL, serta terdiri dari tiga level pengguna yaitu administrator, user, dan calon anggota. Kata kunci : Sistem Pendukung Keputusan, Organisasi , Fuzzy, Mamdani | ABSTRACT DECISION SUPPORT SYSTEM FOR SELECTION OF STUDENT ORGANIZATION MEMBER WITH FUZZY DATABASE METHOD OF WEB BASED TAHANI MODEL (Case Study Of Student Executive Board Of Jenderal Soedirman University) Reyhan Dary Faturrahman Organization is the container for a person to gain experience and skill soft, various forms of organization of many found in lecture form of BEM, DLM, and UKM. So a lot of students who are interested to register for one of the organizations on campus in accordance with their own interests and talents. To facilitate the selection of the members of this student organization made a decision support system. In this research built a support system in order to facilitate selection decisions. members of the student organization with the method of fuzzy database tahani model, this system will do a selection based on a variable that is already defined so that create an ease in making decisions for the selection of members of the Organization. The system is built with the PHP programming language and the MySQL database, and consists of three levels of users i.e. administrators, users, and potential members. Keywords : Decision Support System, Organization , Fuzzy, Mamdani | |
| 19282 | 22524 | H1K014046 | ANALISIS KARAKTERISTIK MASSA AIR DENGAN ENSO (EL NIÑO–SOUTHERN OSCILLATION) DAN IOD (INDIAN OCEAN DIPOLE) DI PERAIRAN TIMUR SUMATERA | Analisis stastistik deskriptif dilakukan untuk mengatahui karakteristik massa air di perairan timur Sumatera terhadap fenomena El Nino Southern Oscilation (ENSO) dan Indian Ocean Dipole (IOD). Perairan tersebut didominasi Karakteristik Bengal Bay water (BBW). Suhu permukaan laut (SPL) sepanjang tahun 2016 lebih tinggi dibandingkan tahun 2017. SPL berkorelasi positif tinggi dengan ENSO pada fase El Nino tahun 2016 dan fase normal tahun 2017. SPL pada fase IOD negatif berkorelasi positif tinggi saat musim barat dan musim peralihan II tahun 2016 sedangkan pada fase IOD positif berkorelasi positif tinggi saat musim peralihan I tahun 2017 dan berkorelasi negatif tinggi saat musim barat tahun 2017. Salinitas permukaan laut pada Januari - Agustus tahun 2016 lebih tinggi dibandingkan tahun 2017, namun pada September - November tahun 2017 lebih tinggi dibandingkan tahun 2016. Salinitas permukaan laut berkorelasi linear negatif tinggi dengan ENSO pada fase normal saat musim peralihan I dan II tahun 2016 dan musim barat tahun 2017 dan berkorelasi positif tinggi dengan ENSO pada fase normal saat musim peralihan II tahun 2017. Salinitas permukaan laut pada fase IOD negatif berkorelasi negatif saat musim barat dan peralihan I tahun 2016, sedangkan pada fase IOD positif berkorelasi negatif tinggi saat musim barat tahun 2017. | Descriptive statistical analysis was performed to determine the characteristics of water masses in eastern Sumatra waters towards the El-Nino Southern Oscillation (ENSO) and Indian Ocean Dipole (IOD). The water masses was dominated by the characteristics of Bengal Bay water (BBW). Sea surface temperature (SST) throughout 2016 was higher than 2017. SST has high positive correlation with ENSO in 2016 and the normal phase in 2017. During negative phase of IOD has high positive correlation in transitional season II in 2016. While in positive IOD phase has high positive correlation when the transition season I in 2017 and has high negative correlation during the western season of 2017. Salinity in January - August 2016 was higher than in 2017, but in September - November was higher than the 2016. Salinity has high negative correlations with ENSO in normal phase during the transition seasons I and II in 2016 and the western season and has high positive correlation with ENSO in the normal phase during the transition season II in 2017. Salinity in the negative IOD phase negatively correlated during western season and transition I 2016, while in IOD positively has high negative correlation during the west season in 2017. | |
| 19283 | 25551 | K1A015052 | ANALISIS HUBUNGAN KUANTITATIF STRUKTUR–SIFAT TERHADAP NILAI KONSENTRASI MISEL KRITIK SURFAKTAN ANIONIK SULFAT BERDASARKAN METODE MEKANIKA KUANTUM | Surfaktan adalah zat yang ditambahkan pada cairan seperti detergen. Detergen umumnya merupakan surfaktan anionik. Parameter untuk mengetahui kinerja surfaktan yaitu Konsentrasi Misel Kritik (KMK). Penelitian ini memiliki tujuan untuk memprediksi QSPR persamaan matematika dari surfaktan anionik sulfat. Penelitian dilakukan dengan memodelkan senyawa surfaktan anionik sulfat ke model tiga dimensi, dioptimasi dengan Hyperchem 8.0 pada metode perhitungan ab initio dengan himpunan basis Large (6-31G**), serta perhitungan deskriptor yang akan dianalisis dengan Multiple Linear Regression (MLR) menggunakan SPSS versi 25.0. Analisis MLR menggunakan dua jenis senyawa yaitu senyawa fitting dan senyawa uji. Nilai terbesar dari setiap deskriptor yaitu pada muatan atom Cpolar sebesar 0,2361 C, muatan atom Cnonpolar sebesar -0,3331 C, polarisabilitas sebesar 37,78 Å, momen dipol sebesar 11,0394 D, indeks refraksi sebesar 100,26 Å3, koefesien partisi n-oktanol-air sebesar 8,68, berat molekul sebesar 386,57 s.m.a, volume Van der Waals sebesar 1241,99 Å3, dan luas permukaan Van der Waals sebesar 747,57 Å2. Kualitas statistik metode backward yang didapat yaitu r = 0,995 ; r2 = 0,990 ; SE = 0,09888 ; Fhitung/Ftabel = 2,80049 pada model ketiga. Variabel tak bebas yaitu Log KMK. Variabel bebas yaitu Log P, volume Van der Waals, Luas permukaan Van der Waals, momen dipol, q.Cpolar, q.Cnonpolar. Hasil perhitungan dengan parameter statistik diperoleh n = 13 ; r = 0,950 ; r2 = 0,902 ; SE = 0,31105 ; Fhitung/Ftabel = 2,138286 ; PRESS = 0,612894. | Surfactants are substances that are added to liquids such as detergents. Detergents are generally anionic surfactants. The parameter to determine the performance of surfactants is the Critical Micelle Concentration (CMC). This study aims to predict the QSPR mathematical equation of anionic sulfate surfactant. The study was conducted by modeling anionic sulfate surfactant compounds into a three-dimensional model. This research optimized by Hyperchem 8.0 on the ab initio calculation method with Large basic set (6-31G **). The descriptor calculation of this research that will be analyzed by Multiple Linear Regression (MLR) using SPSS version 25.0. MLR analysis uses two types of compounds, namely fitting compounds and test compounds. The highest value of each descriptor is Cpolar atomic charge of 0.2361 C, Cnonpolar atomic charge is -0.33331 C, polariability is 37.78 Å, dipole moment is 11.0394 D. The value of refraction index is 100.26 Å3, coefficient n-octanol-water partition of 8.68, molecular weight of 386.57 s.m.a, Van der Waals volume of 1241.99 Å3, and Van der Waals surface area of 747.57 Å2. The statistical qualities of the backward method obtained are r = 0.995; r2 = 0.990; SE = 0.09888; Fcount /Ftable = 2.80049 in the third model. The dependent variable is Log KMK. The independent variables are Log P, Van der Waals volume, Van der Waals surface area, dipole moment, q.Cpolar, q.Cnonpolar. Calculation results obtained with statistical parameters are n = 13; r = 0.950; r2 = 0.902; SE = 0.31105; Fcount /Ftable = 2.138286; PRESS = 0.612894. | |
| 19284 | 22526 | D1E014136 | PENGARUH IMBANGAN Indigofera zollingeriana, SINGKONG DAN RUMPUT GAJAH YANG BERBEDA TERHADAP DEGRADASI PROTEIN KASAR DI RUMEN DAN PASKA RUMEN SECARA IN VITRO | Penelitian bertujuan untuk mengkaji pengaruh imbangan antara rumput gajah, I. zollingeriana, dan singkong dalam ransum ditinjau dari kadar protein kasar di rumen dan paska rumen secara in vitro. Materi yang digunakan dalam penelitian adalah cairan rumen dari 3 ekor sapi potong yang diambil di Rumah Pemotongan Hewan (RPH) Sokaraja sebagai sumber inokulum. Perlakuan yang diuji sebagai berikut: P1= rumput gajah/kontrol 100%; P2 = 75% rumput gajah + 9% I. zollingeriana + 16% singkong; P3 = 50% rumput gajah + 18% I. zollingeriana + 32% singkong; P4 = 25% rumput gajah + 27% I. zollingeriana + 48% singkong. Metode penelitian yang digunakan adalah eksperimental secara in vitro. Rancangan penelitian yang digunakan yaitu Rancangan acak lengkap. Data yang diperoleh dianalisis menggunakan analisis ragam dilanjutkan dengan Uji Duncant new multiple range test (DNMRT). Hasil degradasi protein kasar tertinggi di dalam rumen pada imbangan I. zollingeriana, singkong dan rumput gajah (18% : 32% : 50%) sebesar 70,83% tanpa mengurangi protein kasar yang terlarut dalam pepsin (paska rumen) sebesar 60,61%. Disimpulkan bahwa kombinasi I. zollingeriana dengan singkong mampu meningkatkan degradasi protein di dalam rumen. | The objective of this research was to study the effect of the balance between elephant grass, I. zollingeriana, and cassava in rations in terms of rough protein content in rumen and post-rumen degradation in vitro. The material used in this research were rumen fluid from 3 cattle of Slaughterhouse (RPH) Sokaraja as a source of inoculum. The treatments were tested as follows: P1 = 100% elephant grass / control; P2 = 75% elephant grass + 9% I. zollingeriana + 16% cassava; P3 = 50% elephant grass + 18% I. zollingeriana + 32% cassava; P4 = 25% elephant grass + 27% I. zollingeriana + 48% cassava. The research method used was experimental in vitro. The research design used was complete randomized design. The data obtained were analyzed using multiform analysis followed by Duncant test new multiple range test (DNMRT). The highest crude protein degradation results in rumen in I. zollingeriana, cassava and elephant grass (18%: 32%: 50%) of 70.83% without reducing the crude protein dissolved in pepsin (post-rumen) by 60.61% . It was concluded that combination I. zollingeriana with cassava can increase protein degradation in the rumen. | |
| 19285 | 26264 | H1C014049 | ANALISIS EFEK WAKTU TUNDA TERHADAP PERFORMA PROSES PRESSURE SWING ADSORPTION (PSA) DENGAN PLC UNIT LOC III PT. PERTAMINA RU IV CILACAP (PERSERO) | PT. Pertamina (Persero) RU IV Cilacap merupakan salah satu industri perminyakan sangat mengandalkan kinerja sistem dan salah satu nya adalah proses Pressure Swing Adsorption (PSA) merupakan teknologi yang digunakan untuk memisahkan beberapa jenis gas. Sistem kerja PSA sepenuhnya dikendalikan dengan sistem kendali Programmable Logic Controller (PLC). Satu hal yang nyata dengan masalah sistem kendali jaringan, bahwa waktu tunda pada jaringan akan terjadi, hal ini dapat menurunkan kinerja dari sistem pengendali. Oleh karena itu metode untuk menganalisa efek dari waktu tunda sangat dibutuhkan. Pada penelitian ini sistem PSA menggunakan program simulasi Unity PRO XL dengan desain data waktu siklus yang terjadi sebesar 158 detik. Dengan adanya HMI dapat dilakukan pengamatan terhadap parameter-parameter yang berpengaruh pada sistem diantaranya adalah flowrate(Q), dan tekanan (P). Setelah dilakukan simulasi dan analisa data dari flowrate, tekanan, dan waktu tunda pada PSA didapatkan bahwa setiap penundaan selama 1 detik maka flowrate akan naik sebesar 8.3 dan sebaliknya pada tekanan akan turun sebesar 1.88. Hal ini mempengaruhi produk hasil PSA berupa hidrogen murni dengan menunjukkan perbedaan signifikan dengan waktu tunda yang di uji yaitu pada -1 sec pemulihan bernilai 40.3% dan mengalami penurunan sebesar 10% dari data desain dan pada +1 sec pemulihan menjadi 56% dan mengalami peningkatan sebesar 5%. Dengan kata lain pemulihan hidrogen murni PSA menjadi lebih baik dan efisien. | PT. Pertamina (Persero) RU IV Cilacap is one of the refinery industry that highly dependant on the system's performance and one of the system's performance is Pressure Swing Adsorption (PSA) that using technology for separate some mixture gasses. Work system on PSA is fully controlled by Programmable Logic Controller (PLC). Which one real problem for the network controlled system is delayed time, delayed time can cause decrease meant of performance from controller Because of those methods for analysis effect of delayed time is likely needed. This research is using a simulation program called Unity PRO XL and for a cycle, time design is 158 seconds. With HMI observation for parameters as flowrate (Q) and pressure (P). From the simulation and data analysis of flowrate, pressure and delayed time from PSA results are each 1 second that occurs flowrate increase to 8.3 and contrary for pressure decrease to 1.88. And this affecting the result of PSA products are pure hydrogen and causing a significant difference in testing delayed time that occurs on the system, that on -1-sec recovery value is 40.3% and for +1 sec recovery value is 56%. In other the final PSA product where pure hydrogen recovery is better and efficient. | |
| 19286 | 22525 | A1L014224 | KAJIAN STATUS UNSUR HARA FOSFOR DAN KALSIUM PADA LAHAN PERTANAMAN JAGUNG DI KECAMATAN KEMBARAN KABUPATEN BANYUMAS | Penelitian ini bertujuan untuk mengetahui kandungan unsur hara fosfor dan kalsium dalam tanah serta menentukan rekomendasi pemupukan fosfor pada lahan pertanaman jagung di Kecamatan Kembaran, Kabupaten Banyumas. Penelitian dilaksanakan melalui survei tanah pada lahan pertanaman jagung di Kecamatan Kembaran, Kabupaten Banyumas dari bulan Oktober 2017 sampai dengan Januari 2018. Penentuan titik sampel berdasarkan peta Satuan Lahan Homogen (SLH) dengan skala 1:50.000 (semi-detail). Variabel yang diamati meliputi P-tersedia, Ca-tersedia, pH H2O, pH KCl, dan Daya Hantar Listrik (DHL) tanah. Hasil penelitian menunjukkan bahwa kandungan unsur hara P-tersedia tanah di SLH 1, SLH 2, SLH 3 dan SLH 4 masing-masing sebesar 24,8; 34,2; 22,1 dan 68,7 ppm dan secara keseluruhan tergolong harkat sangat tinggi. Unsur hara kalsium di SLH 1, SLH 2, SLH 3 dan SLH 4 masing-masing sebesar 15,24; 16,63; 16,47 dan 18,16 cmol(+)kg-1 dan secara keseluruhan tergolong harkat tinggi. Pemupukan yang direkomendasikan di lokasi penelitian yaitu pada kandungan P-tersedia tanah rendah di titik sampel 1.2 dan 3.4 dengan pemberian pupuk masing-masing sebesar 1,25 kg P2O5/ha (2,71 kg TSP/ha) dan 12,75 kg P2O5/ha (27,71 kg TSP/ha) dan pada kandungan P-tersedia tanah sangat tinggi tidak diperlukan penambahan pupuk P. | This research aims to determine the nutrient contents of phosphorus and calcium in soil and determine the recommendation of phosphorus fertilization on corn cultivation land in Kembaran Sub-district, Banyumas Regency. The research was conducted through a soil survey on corn cultivation land in Kembaran Sub-district, Banyumas Regency, from October 2017 until January 2018. The determination of sample points based on the map of Homogeneous Land Unit (HLU) with a scale of 1:50.000 (semi-detail). The variables observed included P-available, Ca-available, pH H2O, pH KCl, and Electrical Conductivity. The results showed that nutrient content of P-available soil in HLU 1, HLU 2, HLU 3 and HLU 4 respectively that are 24,8; 34,2; 22,1 and 68,7 ppm and the overall are very high. Calcium nutrients in HLU 1, HLU 2, HLU 3 and HLU 4 respectively that are 15,24; 16,63; 16,47 and 18,16 cmol(+)kg-1 and the overall are high. The recommended fertilization at the research site is on the low of P-available soil content at sample points 1.2 and 3.4 with fertilizer application respectively are 1,25 kg P2O5/ha (2,71 kg TSP/ha) and 12,75 kg P2O5/ha (27,71 kg TSP/ha) and on the very high of P-available soil is not required addition of P fertilizer. | |
| 19287 | 22432 | C1J014014 | FACTORS AFFECTING THE PROFIT OF SMALL MEDIUM ENTERPRISES (SMEs) IN BANYUMAS REGENCY (Tempe Industry in Pliken Village, Kembaran Subdistrict, Banyumas Regency) | Penelitian ini merupakan penelitian data primer dengan mensurvei pada pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Penelitian ini berjudul “Faktor yang Mempengaruhi Profit UKM Tempe di Desa Pliken, Kecematan Kembaran, Kabupaten Banyumas. Tujuan Penelitian ini adalah untuk menganalisis factor yang mempengaruhi jumlah profit pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Populasi dari penelitian ini adalah pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Responden dalam penelitian ini berjumlah 100 orang. Berdasarkan hasil penilitan dapat disimpulkan bahwa terdapat lima variabel secara bersama sama berpengaruh positif signifikan terhadap jumlah profit yang dihasilkan oleh pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Variabel yang berpengaruh adalah modal, tenaga kerja, lama usaha, pendidikan, dan kredit. Secara parsial terdapat empat variabel berpengaruh positif signifikan terhadap profit yaitu modal, tenaga kerja, lama usaha dan pendidikan sedangkan variabel kredit berpengaruh positif tidak signifikan terhadap jumlah profit pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Sementara variabel yang paling berpengaruh terhadap jumlah profit UKM tempe di Desa Pliken adalah Variabel Modal. Hal tersebut ditunjukan dengan nilai koefisien yang bernilai positif dari masing masing variabel terhadap jumlah profit UKM tempe di Desa Pliken, hal tersebut menunjukan bahwa terdapat kenaikan jumlah profit dari pelaku UKM tempe di Desa Pliken yang dikarenakan oleh naiknya jumlah nilai dari satuan masing masing variabel yaitu modal, tenaga kerja, lama usaha, pendidikan, dan kredit. Menurut perhitungan Elastisitas variabel modal memiliki nilai elastisitas yang paling besar diantara yang variabel yang lainnya, oleh Karena itu varibel modal sangat berpengaruh terhadap jumlah profit UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. Implikasi dari kesimpulan diatas yaitu untuk meningkatkan profit pelaku UKM tempe di Desa Pliken terdapat beberapa cara diantaranya, pertama yaitu diharapkan pemerintah dapat memberikan bantuan modal secara lebih optimal yaitu dengan menambah jumlah pinjaman modal dan mempermudah akses terhadap modal. Kedua pemerintah diharapkan memberikan pelatihan pelatihan terhadap para pekerja pada UKM tempe di desa Pliken agar dapat memproduksi tempe dengan lebih efisien dan lebih baik. Dengan begitu diharapakan akan meningkatkan jumlah profit pelaku UKM tempe di Desa Pliken, Kecamatan Kembaran, Kabupaten Banyumas. | This research is about factors that have influence to profit of SMEs tempe in Pliken Village. This research takes the title: Factors Affecting the Profit of Small Medium enterprises (SMEs) in Banyumas Regency (Tempe Industry in Pliken Village, Kembaran Subdistrict, Banyumas Regency). The purpose of this research is to analyze variables capital, labor, period of business, education, and credit into profit SMEs tempe in Pliken Village, Kembaran Subdistrict, Banyumas Regency. This research use quantitative research method with descriptive approach. The object in this research is profit of SMEs tempe in terms of capital, labor, period of business, education, and credit of SMEs tempe in Pliken Village, Kembaran Subdistrict, Banyumas Regency. The result of the research based in the linear data regression analysis show that: (a) capital, labor, period of business, eduction, and credit simultaneously have effect to the profit of SMEs tempe in Pliken Village, (b) capital, labor, period of business partially have positive significant effect on profit SMEs tempe, while education and credit partially have positive and not significant effect profit SMEs tempe in Pliken Village, (c) Capital is the most influential variable to profit of SMEs tempe in Pliken Village. The implication of the above conclusion is that is, local government expected can give assistance into SMEs owner in Pliken village, assistance can be from of capital assitance and scholarship education, because with increase of capital and education level for the owner SMEs tempe it also can increase number of profit that the owner can get, And also local government expected can provide skill training for workforce who work in SMEs Tempe in Pliken village, because with had skill workforce it make efficiently production process to makes tempe and it can increase of profit the owners of SMEs tempe in Pliken Village. | |
| 19288 | 22527 | H1A013031 | ISOLASI SENYAWA AKTIF FRAKSI BUTANOL EKSTRAK DAUN Schima Wallichii SERTA UJI AKTIVITAS SEBAGAI ANTIOKSIDAN | Medang-medangan (Schima Wallichii) merupakan salah satu tumbuhan anggota keluarga Theaceae (teh-tehan). Tumbuhan ini diketahui memiliki aktivitas sebagai antioksidan, antimalaria, antipiretik, dan antikanker. Tujuan dari penelitian ini adalah mengisolasi dan mengidentifikasi senyawa metabolit sekunder fraksi butanol ekstrak metanol daun S. wallichii serta mengetahui aktivitas antioksidan senyawa hasil isolasi. Tahapan pada penelitian ini adalah pengujian aktivitas antioksidan fraksi butanol daun S. wallichii, pemisahan senyawa dan pemurnian senyawa berturut-turut dengan kromatografi kolom vakum, kromatografi kolom gravitasi, uji aktivitas antioksidan senyawa hasil isolasi dengan metode DPPH, serta identifikasi senyawa dengan spektrofotometer FTIR. Hasil uji aktivitas antioksidan fraksi butanol menunjukkan bahwa fraksi butanol daun medang-medangan memiliki aktivitas antioksidan yang sangat kuat dengan nilai IC50 sebesar 12,554 μg/mL. Hasil uji aktivitas antioksidan hasil kromatografi kolom menunjukkan bahwa fraksi F2 memiliki aktivitas antioksidan sangat kuat dengan nilai IC50 sebesar 24,503 μg/mL. Berdasarkan interpretasi spektrum FTIR, senyawa hasil isolasi diduga merupakan golongan flavonoid serta memiliki gugus fungsi yaitu C=O (karbonil), OH (hidroksil), CH sp2, C=N, CH3, C-O, dan CH aromatis. | Medang-medangan (Schima Wallichii) is one of plants belong to tea family (Theaceae). This plant known has activity as antioxidant, antimalarial, antipyretic, and anticancer. The aim of this study is to isolate and identify secondary metabolites of buthanol fraction from methanol extract S.wallichii leaf and also to knowing antioxidant activity isolated compound. Steps in this study are antioxidant activity test of buthanol fraction of S. wallichii leaf, compound separation and purification respectively using vacuum column chromatography, gravitation column chromatography, antioxidant activity test of isolated compound with DPPH, and identification isolated compound of column chromatography with FTIR spectrophotometry. Result of antioxidant activity test of buthanol fraction showed that buthanol fraction has antioxidant activity with IC50 12.554 μg/mL. Result of antioxidant activity test of that four fraction showed that fraction F2 was the stronger antioxidant activity with IC50 24.503 μg/mL. Based on FTIR spectra interpretation, compound in fraction 2 was estimated as flavonoid which have some functional groups such as C=O (carbonyl), OH (hydroxyl), CH sp2, C=N, CH3, C-O, dan CH aromatic. | |
| 19289 | 22528 | A1L014217 | PERTUMBUHAN AKLIMATISASI ANGGREK PHALAENOPSIS PADA BERBAGAI MEDIA TANAM DAN KONSENTRASI PUPUK DAUN | Anggrek merupakan tanaman hias yang memiliki prospek cerah karena harga jual tanaman anggrek stabil. Aklimatisasi merupakan fase yang terjadi pada pembibitan anggrek yang penting dan kritis. Salah satu masalah yang dihadapi pertumbuhan tanaman anggrek adalah kecepatan tumbuh yang relatif lambat. Penelitian ini bertujuan untuk mengetahui penggunaan media tanam dan pemberian konsentrasi pupuk daun yang paling baik untuk mendukung pertumbuhan anggrek pada fase aklimatisasi. Penelitian dilaksanakan di screen house desa Banjarsari Kulon, Kecamatan Sumbang, Banyumas dan Laboratorium Agronomi dan Hortikultura Fakultas Pertanian Universitas Jenderal Soedirman, pada bulan Desember 2017 sampai bulan Maret 2018. Penelitian ini menggunakan Rancangan Acak Kelompok Lengkap (RAKL) dengan 2 faktor, yang terdiri dari 12 kombinasi perlakuan dan diulang sebanyak tiga kali. Hasil dari penelitian menunjukkan bahwa: penggunaan akar kadaka mampu meningkatkan pertambahan luas daun sebesar 57,69% dan pertambahan diameter batang sebesar 35,29% dibandingkan penggunaan serabut kelapa, serta meningkatkan pertambahan luas daun sebesar 22,46% dan pertambahan diameter batang sebesar 12,41% dibandingkan penggunaan pakis. Konsentrasi pupuk Mamigro hijau 2 g/l dapat meningkatkan pertambahan luas daun sebesar 67,45% dan pertambahan jumlah klorofil sebesar 27,76%. Kombinasi jenis media tanam dan konsentrasi pupuk tidak berpengaruh nyata terhadap pertumbuhan tanaman anggrek Phalaenopsis pada fase aklimatisasi. | Orchid is an ornamental plant that has a bright prospect because the sale price of orchid plants is stable. Acclimatization is a phase that takes place in an important and critical orchid breeding. One of the problems facing the growth of orchid plants is the relatively slow growing rate. This study aims to determine the best of planting media used and concentration of leaf fertilizer to support the growth of orchids in the acclimatization phase. The research was conducted at the screen house of Banjarsari Kulon village, Sumbang Subdistrict, Banyumas and Agronomy and Horticulture Laboratory of Faculty of Agriculture, Jenderal Soedirman University, December 2017 until March 2018. This study used Randomized Complete Block Design (RCBD) with 2 factors, 12 treatment combinations and repeated three times. The result of this research showed that kadaka root increased leaf area increase by 57,69% and stem diameter by 35,29% compared to coconut fiber used, and increased leaf area increase by 22,46% and stem diameter by 12,41% compared to the used of fern. Mamigro green fertilizer concentration of 2 g / l could increase the leaf area increase by 67,45% and increased the amount of chlorophyll by 27,76%. The combination of planting media type and fertilizer concentration did not affect significantly on the growth of Phalaenopsis orchid plants in the acclimatization phase. | |
| 19290 | 22529 | A1L014011 | PENGARUH KONSENTRASI LARUTAN VITAMIN C DAN TEKNIK PEMOTONGAN TANGKAI BUNGA TERHADAP KESEGARAN BUNGA POTONG ANGGREK (Vanda douglas) | Bunga anggrek (Vanda douglas) merupakan salah satu jenis anggrek yang banyak diminati oleh masyarakat Indonesia dan mempunyai nilai ekonomi tinggi karena warna dan bentuknya yang indah. Salah satu masalah yang dihadapi bunga potong anggrek adalah penanganan pasca panen yang kurang optimal dengan menggunakan air saja. Penelitian ini bertujuan untuk mengetahui pengaruh terhadap pemberian konsentrasi larutan vitamin C untuk memperpanjang kesegaran bunga potong anggrek, mengetahui teknik pemotongan pangkal tangkai bunga yang tepat untuk memperpanjang kesegaran bunga potong anggrek, dan mengetahui kombinasi konsentrasi vitamin C dan teknik pemotongan pangkal tangkai bunga untuk memperpanjang kesegaran bunga potong anggrek. Penelitian dilaksanakan di Laboratorium Agronomi dan Hortikultura Fakultas Pertanian Universitas Jenderal Soedirman, pada bulan Maret sampai bulan April 2018. Penelitian ini menggunakan Rancangan Acak Kelompok Lengkap (RAKL) pola faktorial dengan 2 faktor, yang terdiri dari 12 kombinasi perlakuan dan diulang sebanyak tiga kali. Hasil dari penelitian menunjukan bahwa: pemberian vitamin C 100 ppm dapat mempertahankan warna bunga sampai hari ke 13 sebesar 2,31, pemotongan di dalam air setiap 2 hari sekali dapat menambah larutan terserap sebesar 28,33 ml lebih banyak 8,61 ml dari kontrol, kombinasi perlakuan konsentrasi vitamin C 100 ppm dan teknik pemotongan tangkai di dalam air setiap dua hari sekali dapat memperpanjang masa keseragan bunga awal Vanda douglas hingga 10,88 hari atau lebih 3,21 hari lebih lama dari kontrol. | Orchid (vanda douglas) is a type of orchids which attracts Indonesian people attention and has a high economic value because it has beautiful color and shape. It faces one problem, post-harvest care which is less optimal because it only uses water. This research aims to find out the effect of vitamin C solution concentration, to identify the best stalk cutting technique and to determine the combination of vitamin C concentration and flower stalk cutting technique to extend the cut flower’s vase life. This experiment was conducted in Agronomy and Horticulture Laboratory of Faculty of Agriculture, Jenderal Soedirman University, from March to April 2018. This study used Completely Randomized Block Design (CRBD) with two factorial patterns consisting of 12 treatment combinations and was repeated three times. The result shows that 100 ppm vitamin C can maintain the color of the flowers until day 13 for 2,31, cutting the stalk in the water every once in two days can add the absorbed solution up to 28.33 ml, which is 8.61 over the control, and the treatment combination of 100 ppm vitamin c concentration and the flower stalk cutting technique in the water every once in two days can extend the orchid’s vase life up to 10.88 days or 3,21 days longer than the control. | |
| 19291 | 22530 | E1A011244 | TANGGUNG JAWAB PT SINAR JAYA MEGAH LANGGENG SEBAGAI PENGANGKUT TERHADAP PENUMPANG YANG MENDERITA KERUGIAN AKIBAT ADANYA KECELAKAAN BERDASARKAN UNDANG-UNDANG NOMOR 22 TAHUN 2009 TENTANG LALU LINTAS DAN ANGKUTAN JALAN | TANGGUNG JAWAB PT SINAR JAYA MEGAH LANGGENG SEBAGAI PENGANGKUT TERHADAP PENUMPANG YANG MENDERITA KERUGIAN AKIBAT ADANYA KECELAKAAN BERDASARKAN UNDANG-UNDANG NOMOR 22 TAHUN 2009 TENTANG LALU LINTAS DAN ANGKUTAN JALAN Oleh: Martin Indra Setiawan (E1A011244) Pengangkutan merupakan bidang kegiatan yang sangat penting dalam kehidupan masyarakat Indonesia. Pentingnnya pengangkutan bagi masyarakat Indonesia disebabkan oleh beberapa faktor antara lain, keadaan geografis Indonesia yang terdiri dari ribuan pulau kecil dan besar, perairan yang terdiri dari sebagian besar laut, sungai dan danau yang memungkinkan pengangkutan dilakukan melalui darat, perairan, dan udara guna menjangkau seluruh wilayah Indonesia. Penelitian ini bertujuan untuk mengetahui tanggung jawab PT Sinar Jaya Megah Langgeng sebagai pengangkut terhadap penumpang yang mengalami kerugian akibat adanya suatu peristiwa kecelakaan. Berdasarkan penelitian ini diperoleh hasil bahwa tanggung jawab PT Sinar Jaya Megah Langgeng sebagai pengangkut terhadap penumpang yang menderita kerugian akibat adanya kecelakaan berdasarkan Undang-Undang Nomor 22 Tahun 2009 tentang Lalu Lintas dan Angkutan jalan, adalah tanggung jawab perdata berkaitan dengan Pasal 191 dan Pasal 237 ayat (1), dimana supir bus PT Sinar Jaya Megah Langgeng lalai dalam kegiatan pengangkutan yang menyebabkan penumpang tidak sampai ketempat tujuan dengan selamat, dimana supir bus PT Sinar Jaya Megah Langgeng merupakan orang yang dipekerjakan oleh PT Sinar Jaya Megah Langgeng dalam kegiatan penyelenggaraan pengangkutan. Pihak PT Sinar Jaya Megah Langgeng sendiri telah melakukan tanggung jawab dalam bentuk ganti rugi kepada penumpang yang membutuhkan perawatan sejumlah Rp. 1.500.000,00. serta membantu penumpang yang bersangkutan untuk melakukan klaim asuransi PT Jasa Raharja. | RESPONSIBILITY OF PT SINAR JAYA MEGAH LANGGENG AS A TRANSPORT SERVICE PROVIDER TOWARD PASSENGERS WHO HAVE DAMAGES DUE TO ACCIDENT BASED ON LAW NUMBER 22 OF 2009 CONCERNING TRAFFIC AND ROAD TRANSPORTATION Submitted by: Martin Indra Setiawan (E1A011244) Transportation is a very important field of activity in the lives of Indonesian people. The importance of transportation for the people of Indonesia is caused by several factors, among others, the geographical condition of Indonesia which consists of thousands of small and large islands, territorial waters consisting of most of the seas, rivers and lakes that allow transportation to be carried out by land, water and air to reach all regions of Indonesia. This research aims to find out the responsibility of PT. Sinar Jaya Megah Langgeng as a public transport service provider for passengers who have suffered losses due to an accident. Based on this research, it was obtained the results that the responsibility of PT. Sinar Jaya Megah Langgeng as a public transport service provider for passengers who suffered losses due to accident based on Law No 22 of 2009 regarding Traffic and Road Transportation, is civil liability related to Article 191 and Article 237 paragraph (1), where bus driver of PT. Sinar Jaya Megah Langgeng is negligent in transport activities which causes passengers not to reach the destination safely, where the bus driver of PT. Sinar Jaya Megah Langgeng is a person that employed by PT. Sinar Jaya Megah Langgeng in the transportation operation. PT. Sinar Jaya Megah Langgeng itself has carried out the responsibility in the form of compensation to passengers who need treatment of Rp. 1,500,000.00. Assisting the passenger concerned to claim insurance for PT. Jasa Raharja as well. | |
| 19292 | 22531 | F1G014033 | REPRESENTASI TRADISI SIRI’ SUKU BUGIS PADA NOVEL SILARIANG CINTA YANG (TAK) DIRESTUI KARYA OKA AURORA | Penelitian berjudul “Representasi Tradisi Siri’ Suku Bugis pada Novel Silariang Cinta Yang (Tak) Direstui Karya Oka Aurora” mendeskripsikan tradisi siri’ yang ada di Suku Bugis Makassar dalam novel Silariang Cinta Yang (Tak) Direstui karya Oka Aurora. Penelitian ini menggunakan metode deskriptif analisis dengan fokus penelitian mengenai analisis tradisi siri’ Suku Bugis pada novel Silariang Cinta Yang (Tak) Direstui karya Oka Aurora. Teknik pengumpulan data yang digunakan, yaitu membaca isi novel, kemudian menginventarisasi dan mengkasifikasi data yang berkaitan dengan rumusan masalah. Teknik analisis dilakukan dengan mendeskripsikan tradisi siri’ Suku Bugis pada novel Silariang Cinta Yang (Tak) Direstui berdasarkan tujuh unsur kebudayaan yang meliputi bahasa, sistem teknologi, sistem mata pencarian, organisasi sosial, sistem pengetahuan, sistem religi dan kesenian. Selanjutnya data dianalisis dengan pendekatan antropologi sastra, kemudian hasil analisis disimpulkan. Hasil analisis unsur intrinsik yang telah diuraikan, terbukti bahwa unsur unsur tokoh dan penokohan, alur, dan latar menjadi unsur pembangun dalam novel Silariang Cinta Yang (Tak) Direstui karya Oka Aurora. Berdasarkan unsur pembangun yang telah diuraikan, tradisi siri’ dalam novel ini muncul melalui tujuh unsur kebudayaan yang meliputi bahasa, sistem teknologi, sistem mata pencarian, organisasi sosial, sistem pengetahuan, sistem religi dan kesenian. Maka dari itu, dapat disimpulkan bahwa masyarakat Suku Bugis sangat menjunjung tinggi tradisi siri’. | The research entitled “Representasi Tradisi Siri’ Suku Bugis pada Novel Silariang Cinta Yang (Tak) Direstui Karya Oka Aurora” describes siri’ tradition which exists in Makassar Bugis societies in the novel Silariang Cinta Yang (Tak) Direstui written by Oka Aurora. The research used descriptive analysis method which focused researching analysis of siri’ tradition on Bugis tribe based on novel Silariang Cinta Yang (Tak) Direstui by Oka Aurora. Techniques of collecting data were, reading the novel, inventorizing and classifying data that related to the research question. The technique of analysis was done by describing siri’ tradition of Bugis tribe in the novel Silariang Cinta Yang (Tak) Direstui using seven elements of culture; language, technology, economic system, knowledge system, social organization, religion, and art. Furthermore, data analyzed using literary anthropology approach, the outcome of the analysis be concluded. The results of the analysis of the intrinsic elements that have been carried out, it is proven that the elements of characther and characterization, plot, and setting become a constructor in the novel mentioned. Based on those elements that had been described, siri’ in the novel appeared through seven elements of culture. These are language, technology, economic system, knowledge system, social organization, religion, and art. Therefore, it can be concluded that Bugis societies uphold siri’ tradition. | |
| 19293 | 22532 | H1E014032 | Pendugaan Kedalaman Akuifer Menggunakan Teknik Vertical Electrical Sounding Dan Perbandingannya Dengan Hasil Bor Di Desa Pekuncen Kecamatan Jatilawang Kabupaten Banyumas | Penelitian dilakukan dengan metode geolistrik tahanan jenis teknik vertical electrical sounding di Desa Pekuncen Kecamatan Jatilawang Kabupaten Banyumas. Penelitian ini menggunakan 3 lintasan dengan panjang lintasan 1 dan 3 sejauh 200 meter sedangkan lintasan 2 sejauh 240 meter. Kemudian saat pengeboran sampel batuan diambil setiap kedalaman 5 meter. Hasil interpretasi sampel batuan dikorelasikan dengan hasil survei geolistrik yakni jenis dan ketebalan masing-masing lapisan batuan di bawah permukaan. Hasil dari penelitian ini menunjukkan bahwa akuifer pada daerah penelitian terdiri dari 2 bagian, yakni akuifer bebas dan akuifer tertekan. Akuifer bebas pada titik sounding 1 terletak pada kedalaman 6,80-34,38 m, titik sounding 2 pada kedalaman 7,00-28,89 m, dan titik sounding 3 pada kedalaman 4,39-31,39 m. Sedangkan akuifer tertekan pada titik sounding 1 terletak pada kedalaman lebih dari 48,24 m, titik sounding 2 pada kedalaman lebih dari 47,22 m, dan titik sounding 3 pada kedalaman lebih dari 47,36 m. Korelasi antara survei geolistrik pada titik sounding 2 dengan interpretasi batuan hasil bor menunjukkan perbedaan jenis batuan dan ketebalan jenis batuan. Perbedaan jenis batuan terletak pada interpretasi hasil bor yang membagi pasir pada akuifer tertekan menjadi pasir halus, pasir sedang, dan pasir kasar. Perbedaan ketebalan setelah melakukan korelasi tidak lebih dari 2 meter. | The research was conducted with the method of geolistrik resistance type Vertical Electrical Sounding technique in Pekuncen Village, Jatilawang Sub-district, Banyumas Regency. This study used 3 lines with track lengths 1 and 3 as far as 200 meters while track 2 as far as 240 meters. Then when rock drilling samples are taken every 5 meters depth. The results of the rock sample interpretation were correlated with the geoelectric survey results ie the type and thickness of each layer of rocks below the surface. The results of this study indicate that the aquifer in the study area consists of 2 parts, namely the unconfined aquifer and a confined aquifer. The unconfined aquifer at sounding point 1 lies at a depth of 6.80 to 34.38 m, sounding point 2 at a depth of 7.00 to 28.89 m, and a sounding point of 3 at a depth of 4.39-31.39 m. While the confined aquifer at the sounding point 1 lies at a depth of over 48.24 m, the sounding point 2 at a depth of over 47.22 m, and the sounding point 3 at a depth of over 47.36 m. The correlation between the geoelectric survey on line 2 with the interpretation of drill rock shows the difference of rock type and rock type thickness. The different types of rocks lie in the interpretation of drill results that divide the sand on a confined aquifer into fine sand, moderate sand, and coarse sand. The difference in thickness after correlation is not more than 2 meters. | |
| 19294 | 22533 | H1E014012 | APLIKASI METODE GEOLISTRIK RESISTIVITAS UNTUK EKSPLORASI SUMBER AQUIFER TERTEKAN DI DESA KALIBAGOR, KECAMATAN KALIBAGOR, KABUPATEN BANYUMAS | Eksplorasi sumber aquifer tertekan menggunakan metode geolistrik resistivitas konfigurasi Schlumberger di Desa Kalibagor, Kecamatan Kalibagor, Kabupaten Banyumas telah dilakukan. Akuisisi dilakukan di tiga titik lintasan, yaitu lintasan Sch1, Sch2, dan Sch3 dengan masing-masing panjang lintasan 200 m. Hasil interpretasi menunjukkan terdapat lima jenis batuan pada daerah penelitian, di antaranya lapisan tanah, lanau pasiran (kering), lempung pasiran, lempung, dan batu pasir. Pengolahan data resistivitas 1D konfigurasi Schlumberger diperoleh lima lapisan batuan pada lintasan Sch1, diantaranya lapisan tanah penutup pada kedalaman 0 - 2,19 m dengan resistivitas 101,02 Ωm, lanau pasiran (kering) pada kedalaman 2,19 - 9,68 m dengan resistivitas 40,68 Ωm, pasir berbutir halus pada kedalaman 9,68 - 14,23 m dengan resistivitas 1,22 Ωm, lempung pada kedalaman 14,23 - 39,01 m dengan resistivitas 19,35 Ωm, dan pasir berbutir halus pada kedalaman >39,01 m dengan resistivitas 0,99 Ωm. Lintasan Sch2 diperoleh tiga lapisan batuan, di antaranya tanah permukaan lanauan pada kedalaman 0 - 4,27 m dengan resistivitas 51,92 Ωm, lanau pasiran (kering) pada kedalaman 4,27 - 13,15 m dengan resistivitas 33,83 Ωm, dan pasir berbutir sedang pada kedalaman >13,15 m dengan resistivitas 7,05 Ωm. Lintasan Sch3 diperoleh empat lapisan batuan diantaranya lanau pasiran (kering) pada kedalaman 0 - 3,69 m dengan resistivitas 31,78 Ωm, lempung pasiran pada kedalaman 3,69 - 9,20 m dengan resistivitas 25,37 Ωm, pasir berbutir sedang pada kedalaman 9,20 - 85,52 m dengan resistivitas 6,61 Ωm, pasir berbutir halus pada kedalaman >85,52 m dengan resistivitas 1,69 Ωm. Aquifer tertekan berada pada lintasan Sch1 tersusun atas lapisan pasir berbutir halus pada kedalaman >39,01 m dengan resistivitas 0,99 Ωm. | Exploration of Confined aquifer resource using Geoelectrical resistivity method Schlumberger configuration has done in Kalibagor Village, Kalibagor District, Banyumas Regency. Acquisition carried out in three line, namely Sch1, Sch2, and Sch3 with each of line has a length of 200 m. The result of Interpretation shows that there five layers of rock in the research area. Those are soil, sandy silt (dry), sandy clay, clay and sandstone. Schlumberger configuration resistivity data processing has obtained five layers rock, Sch1 line obtained of top soil which has a depth of 0 - 2,19 m with resistivity value of 101,02 Ωm, sandy silt (dry) has a depth of 2,19 - 9,68 m with resistivity value of 40,68 Ωm, smooth grained sand has a depth of 9,68 - 14,23 m with resistivity value of 1,22 Ωm, clay has a depth of 14,23-39,01 m with resistivity value of 19,35 Ωm, and smooth grained sand has a depth of >39,01 m with resistivity value of 0,99 Ωm. Sch2 line has obtained three layers of rocks, they are top soil and silt which has a depth of 0 - 4,27 m with resistivity value of 51,92 Ωm, sandy silt (dry) has a depth of 4,27 - 13,15 m with resistivity value of 33,83 Ωm, and medium grained sand has a depth of >13,15 m with resistivity value of 7,05 Ωm. Sch3 line has obtained four layers of rocks, they are sandy silt (dry) ) has a depth of 0 - 3,69 m with resistivity value of 31,78 Ωm, sandy clay has a depth of 3,69 - 9,20 m with resistivity value of 25,37 Ωm, medium grained sand has a depth of 9,20-85,52 m with resistivity value of 6,61 Ωm, and smooth grained sand has a depth of >85,52 m with resistivity value of 1,69 Ωm. Confined aquifer is found in Sch1 line with the layer is smooth grained sand which has a depth of >39,01 m with resistivity value of 0,99 Ωm. | |
| 19295 | 22534 | E1A014058 | PERAN KEPOLISIAN DALAM PENANGANAN TERHADAP KASUS TINDAK PIDANA KEKERASAN DALAM RUMAH TANGGA (KDRT) (Studi di Polres Banyumas) | Peran kepolisian dalam penanganan terhadap kasus tindak pidana kekerasan dalam rumah tangga di Polres Banyumas sudah berperan secara maksimal hal tersebut dapat dilihat bahwa kasus Kekerasan dalam Rumah Tangga (KDRT) yang dilaporkan di Polres Banyumas dalam kurun waktu lima tahun terakhir (2013-2017) secara keseluruhan berjumlah 27 kasus. Kasus KDRT yang dapat diselesaikan oleh pihak kepolisian sebanyak 21 kasus, sehingga menyisahkan 6 kasus yang tidak terselesaikan karena dicabut oleh pelapor. Hal tersebut menarik untuk dikaji agar mengetahui peran kepolisian Polres Banyumas dalam menangani kasus tindak pidana kekerasan dalam rumah tangga (KDRT) dan faktor-faktor penghambat dan pendorong kepolisian dalam menangani kasus tindak pidana kekerasan dalam rumah tangga (KDRT) di Kabupaten Banyumas. Penelitian ini menggunakan metode pendekatan yuridis sosiologis dan spesifikasi penelitian secara deskriptif. Lokasi penelitian di Polres Banyumas dan Pusat Pelayanan Terpadu Penanganan Kekerasan Berbasis Gender dan Anak (PPT-PKBGA) Kabupaten Banyumas. Metode penentuan sampel yaitu purposive sampling dan snowball sampling. Jenis dan sumber data adalah data primer dan data sekunder. Penyajian data dalam bentuk teks naratif dan table. Metode analisis data secara deskriptif kualitaif. Berdasarkan hasil penelitian penanganan terhadap kasus kekerasan dalam rumah tangga yang dilakukan oleh Polres Banyumas sudah maksimal. Faktor-faktor yang menghambat kepolisian dalam penanganan kasus kekerasan dalam rumah tangga yaitu kesulitan mendatangkan saksi-saksi dan banyak kasus yang tidak dilaporkan sehingga polisi tidak dapat bertindak, serta faktor pendorongnya yaitu adanya koordinasi yang baik antara kepolisian sehingga memudahkan dalam menyelesaikannya, kemudian masyarakat yang mengetahui adanya kasus kekerasan dalam rumah tangga mau melaporkannya kepada pihak kepolisian. | The role of the police in the handling of crimnal cases of domestic violence in Polres Banymas have been actively involved it can be seen that cases of Domestic Violence (KDRT) reported in Polres Banyumas in the last five years (2013-2017) is amounted to 27 cases in total. Cases of domestic violence that can be resolved by the police as many as 21 cases, remaining 6 cases that are not resolved because they are revoked by the complainant. It is interesting to examine to know deeply about the role of Polres Banyumas and obstacles faced and the push factors by the police in handling cases of Domestic Violence (KDRT) in Banyumas Regency. This research uses sociological juridical approach method and descriptive research specification. The research take a place at Polres Banyumas and Integrated Service Center for Gender and Child Based Violence Management (PPT-PKBGA) in Banyumas Regency. The types and sources of data are primary data such as the result of interview and secondary data such as literature study. Presentation of data in the form of narrative text and table. Method of data analysis is descriptive qualitative. The results of research on cases of domestic violence conducted by Polres Banyumas has been maximized. The factors that cause the police in handling the cases of domestic violence are from the difficult of bringing witnesses and many cases that are not reported so that the police can not act, as well as the push factors is the existence of good coordination between the police making it easier to get it done, then people who are aware of cases of domestic violence whould report it to the police. | |
| 19296 | 22535 | E1A011233 | PERLINDUNGAN HUKUM TERHADAP KONSUMEN JASA PROVIDER PT TELEKOMUNIKASI SELULER (TINJAUAN YURIDIS PUTUSAN MAHKAMAH AGUNG NOMOR.336K/PDT.SUS/2012) | ABSTRAK Penelitian ini mengambil judul “Bagaimana perlindungan hukum konsumen terhadap tanggung jawab jasa provider atas iklan Paket Blackberry Unlimited berdasarkan putusan hukum dari Mahkamah Agung dalam menyelesaikan sengketa konsumen di tingkat kasasi antara Muhammad Taufiq Melawan PT. Telekomunikasi Seluler (Studi Putusan Hakim Nomor:336K/Pdt.Sus/2012)?”. Penelitian ini dilakukan untuk menganalisis Bagaimana perlindungan hokum terhadap konsumen akibat iklan Paket Blackberry Unlimited berdasarkan Undang-undang Nomer 8 Tahun 1999 Tentang Perlindungan Konsumen Metode pendekatan dalam penulisan ini adalah yuridis normatif, spesifikasi penelitian ini adalah penelitian deskriptif kualitatif. Sumber data menggunakan data sekunder. Teknik pengumpulan data menggunakan studi kepustakaan/studi dokumen.Teknik analisis data menggunakan analisi deskriptif kualitatif, dimana menjelaskan uraian-uraian fakta hukum, kemudian dikaitkan dengan hasil penelitian yang ada. Berdasarkan hasil penelitian yang telah dilakukan, diperoleh kesimpulan bahwa perlindungan hukum terhadap konsumen jasa provider sudah sesuai dengan Undang-undang Nomor 8 tahun 1999 tentang Perlindungan Konsumen dan Pasal 27, Pasal 28D Ayat (1), Pasal 33 UUD 1945 dalam memeriksa sengketa tentang iklan tarif layanan BlackBerry telepon seluler dari provider Telkomsel oleh konsumen yang merasa dirugikan dalam kasus ini, Putusan hakim bahwa Pelaku Usaha tidak terbukti melakukan pelanggaran atas ketentuan dalam Pasal 4 huruf a, Pasal 7 huruf b, Pasal 9 ayat (1) huruf j dan k, dan/atau Pasal 10 huruf (a) Undang-undang RI Nomor 8 Tahun 1999 Tentang Perlindungan Konsumen bahwa bukan iklan yang berlebihan dan dapat merugikan konsumennya, dimana sebelumnya telah memberikan informasi mengenai informasi tersebut kepada Konsumen. Putusan hakim dalam penyelesaian sengketa kasus ini bahwa pihak konsumen harus membayar sanksi denda pembayaran pihak Pelaku Usaha dan biaya perkara sesuai hasil putusan penolakan gugatan kasasu oleh Pihak Termohon Keberatan dahulu Pengadu/Konsumen. Kata Kunci: Penyelesaian Sengketa Konsumen, Perlindungan Konsumen. | ABSTRACT This study takes the title "How is the legal protection of consumers against the responsibility of service providers for Blackberry Unlimited Package advertising based on a legal decision from the Supreme Court in resolving consumer disputes at the cassation level between Muhammad Taufiq Against PT. Cellular Telecommunication (Study of Judge's Decision Number: 336K / Pdt.Sus / 2012)? ". This research was conducted to analyze how legal protection for consumers due to Blackberry Unlimited Package ads based on the Law Number 8 of 1999 concerning Consumer Protection The method of approach in this writing is normative juridical, the specification of this research is qualitative descriptive research. Data sources use secondary data. Data collection techniques using literature study / document study. Data analysis techniques using qualitative descriptive analysis, which describes the descriptions of legal facts, then associated with the results of existing research. Based on the results of research conducted, it was concluded that legal protection for consumers of service providers is in accordance with Law Number 8 of 1999 concerning Consumer Protection and Article 27, Article 28D Paragraph (1), Article 33 of the 1945 Constitution in examining disputes regarding tariff advertising BlackBerry cell phone services from Telkomsel providers by consumers who feel aggrieved in this case, the judge's decision that the Business Actor is not proven to have violated the provisions in Article 4 letter a, Article 7 letter b, Article 9 paragraph (1) letter j and k, and / or Article 10 letter (a) of Republic of Indonesia Law Number 8 of 1999 concerning Consumer Protection that is not excessive advertising and can harm consumers, where previously it has provided information about the information to the Consumer. Judge's decision in settling the dispute in this case is that the consumer must pay the penalty of payment of the Business Actor and court fees in accordance with the result of the decision to reject the kasasu claim by the Respondent. Keywords: Consumer Dispute Resolution, Consumer Protection. | |
| 19297 | 22536 | B1J014045 | KARAKTERISASI MOLEKULER IKAN TERI (Stolephorus commersonnii) DI SEGARA ANAKAN CILACAP BERDASARKAN MARKA PCR-RFLP GEN SITOKROM C OKSIDASE 1 (CO1) | Ikan teri (Stolephorus commersonnii) merupakan jenis ikan pelagis kecil yang hidup secara berkelompok dan keberadaannya cukup melimpah di Segara Anakan Cilacap. Ikan teri banyak dimanfaatkan sebagai bahan makanan sehingga memiliki nilai komersial yang tinggi. Namun, hal tersebut menyebabkan laju eksploitasi yang tinggi terhadap populasi ikan teri. Secara molekuler, eksploitasi dapat berakibat pada penurunan keragaman genetik suatu populasi. Umumnya populasi yang tereksploitasi memiliki keragaman genetik yang rendah. Penelitian ini bertujuan untuk mengetahui polimorfisme, keragaman haplotipe dan keragaman lokus marka PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) gen CO1 pada populasi ikan teri di Segara Anakan Cilacap. Penelitian ini dilakukan mulai Januari-April 2018 dan menggunakan metode survey random sampling. Sebanyak 30 sampel ikan teri diambil secara acak dari koleksi Laboratorium Taksonomi Hewan. Genom mtDNA diisolasi menggunakan metode Chelex. Gen Sitokrom C Oksidase 1 (CO1) diamplifikasi dengan teknik PCR. Primer yang digunakan adalah sepasang internal forward primer 5'ATCTTTGGTGCATGAGCAGGAATAGT3' dan primer FishR2 reverse: 5'ACTTCAGGGTGACCGAAGAATCAGAA3'. Produk PCR sepanjang 650 pasang basa (pb) dipotong dengan empat enzim restriksi. Enzim HindIII menghasilkan fragmen berukuran 416 bp dan 234 bp, enzim VspI menghasilkan ukuran 435 bp dan 214 bp, enzim TaqI menghasilkan ukuran 556 bp dan 94 bp serta enzim RsaI menghasilkan ukuran 319 bp, 183 bp dan 148 bp. Fragmen RFLP yang dihasilkan tersebut muncul pada semua sampel dan menghasilkan ukuran dan pola pita yang seragam pada semua individu ikan teri. Hal ini menunjukkan bahwa gen CO1 pada populasi ikan teri di Segara Anakan Cilacap bersifat monomorfik karena memiliki alel yang sama. Oleh karena itu, disimpulkan bahwa marka PCR-RFLP gen CO1 ikan teri di Segara Anakan Cilacap tidak memperlihatkan adanya variasi genetik dan menunjukkan nilai keragaman haplotipe sebesar 0 (nol) serta keragaman lokus sebesar 0%. | Commerson’s anchovy (Stolephorus commersonnii) is a small pelagic fish that live in a group and its existence is quite abundant in Segara Anakan Cilacap. This anchovy is widely consumed as the food so it has a high commercial value which leads to a high exploitation rate of the anchovy population. High exploitation may result in a decrease in the genetic diversity of a population. Exploited populations generally have low genetic diversity. This study aims to know the polymorphism, haplotype diversity, and loci diversity of PCR-RFLP markers (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) CO1 gene on anchovies population in Segara Anakan Cilacap. This study was conducted from January to April 2018 and used survey method by applying random sampling. As many as 30 samples of anchovy were taken from the collection in Animal Taxonomy Laboratory. Genomic mtDNA was isolated using Chelex method. Cytochrome C Oxidase 1 gene were amplified with PCR technique. The primer used was a pair forward primer 5'ATCTTTGGTGCATGAGCAGGAATAGT3' and FishR2 5'ACTTCAGGGTGACCGAAGAATCAGAA3'. PCR products of 650 pairs of bases (pb) length were cut with four restriction enzymes. The HindIII enzymes produces CO1 fragment with the size of 416 bp and 234 bp lengths, CO1-VspI produces 435 bp and 214 bp, CO1-TaqI produces 556 bp and 94 bp and CO1-RsaI produces 319 bp, 183 bp, and 148 bp fragments, espectively. The generated PCR-RFLP fragments appear on all samples and produce a uniform band pattern on all anchovy individuals. This suggests that the CO1 gene of anchovy population in Segara Anakan Cilacap was monomorphic because it has similar alleles. Therefore, it can be concluded that PCR-RFLP markers of CO1 gene on anchovy in Segara Anakan Cilacap dies not show genetic diversity and show the haplotype diversity value was 0 (zero) and loci diversity value was 0% | |
| 19298 | 22537 | A1H013018 | KAJIAN MOTIVASI PERKUMPULAN PETANI PEMAKAI AIR (P3A) DALAM PENGELOLAAN AIR IRIGASI DI KABUPATEN BANYUMAS DENGAN PENDEKATAN MEANS END CHAIN | Perkumpulan Petani Pemakai Air (P3A) merupakan lembaga lokal pengelola irigasi yang ada di wilayah Kabupaten Banyumas. Perkembangan yang ada menunjukan P3A dihadapkan pada gejolak pasokan air, infrastruktur irigasi dan motivasi pengurus untuk terus mengelolanya atau tidak melanjutkan pengelolaannya, yang menyebabkan adanya perbedaan kinerja antara P3A yang aktif dan P3A yang tidak aktif di Kabupaten Banyumas. Perbedaan motivasi sejalan dengan pernyataan para ahli irigasi yang menyarankan penelitian sebaiknya difokuskan pada lembaga-lembaga yang mengelola air. Penelitian ini bertujuan untuk 1) mengetahui sosial-demografi kelompok P3A, 2) mendapatkan atribut, konsekuensi dan nilai menggunakan metode Means End Chain (MEC), dan 3) mengetahui hierarki motivasi P3A masih aktif dan pengurus P3A yang sudah tidak aktif mengelola irigasi. Penelitian dilaksanakan secara survei di Kabupaten Banyumas meliputi Kecamatan Pekuncen, Ajibarang, Cilongok, Sumbang, Kembaran, Somagede, Banyumas, Kalibagor, Patikraja, Jatilawang, Rawalo, dan Wangon. Penelitian dilaksanakan dari bulan Desember 2017- Februari 2018. Metode pengambilan sample menggunakan teknik snowball sampling. Metode Means End Chain (MEC) digunakan untuk menentukan motivasi pengurus P3A yang terus mengelolanya atau tidak melanjutkan pengelolaannya. Data diolah menggunakan MEC Analysis. Tahapan pengolahan data meliputi 1) coding yaitu pemberian kode pada topik, 2) membuat Implikasi matriks, 3) membuat Hierachical Value Map (HVM) dan 4) interpretasi data. Variabel yang diukur adalah abstractness ratio dan centrality index. Hasil penelitian menunjukan untuk P3A melanjutkan pengelolaan irigasi memiliki centrality Index yang tertinggi yaitu ‘bahagia’ (0,12); ‘mendapatkan uang’ (0,12); dan ‘membagi air’(0,12) merupakan topik yang paling banyak disebutkan oleh 51 responden. P3A tidak melanjutkan pengelolaan irigasi memiliki centrality Index yang tertinggi yaitu ‘sedih’ (0,12); dan ‘managemen SDM buruk’ (0,12). merupakan topik yang paling banyak disebutkan oleh 51 responden. Upaya yang harus dilakukan untuk perbaikan motivasi yakni pemberdayaan terhadap pengurus P3A melalui pendampingan dilapangan berserta upaya peningkatan taraf ekonomi. | Water User Associations (P3A) is a traditional water management institution irrigation Banyumas Regency. Problems emerged during the P3A Development include: 1) fluctuation of water suply, 2) irrigation infrastructure, 3) Less motivation to manage the organization. The difference of motivation between members of P3A active and not active raise question as suggested by irrigation expert. This study are to 1) know the social demographics of respondend 2) obtain attributes, consequences and values using Means End Chain (MEC) method, and 3) investigate administrators P3A motivation hierarchy of are administrators who still actively managing irrigation and not actively managing P3A irrigation. The research was carried out in Banyumas District covering Pekuncen, Ajibarang, Cilongok, Sumbang, Kembaran, Somagede, Banyumas, Kalibagor, Patikraja, Jatilawang, Rawalo and Wangon subdistricts. The study was conducted from December 2017 to February 2018. Sampling method using snowball sampling technique. The Means End Chain (MEC) method was used to determine the motivation of P3A members who continue or not to continue to manage organixation. The data is processed using MEC Analysis. Stages of data processing include 1) coding, 2) creating implications matrix, 3) generating Hierachical Value Map (HVM), and 4) interpretatig data. The measured variables were the abstractness ratio and the centrality index. The results showed that of P3A that continued to manage irrigation. The highest centrality index is 'happy' (0.12); 'Earn money' (0.12); and 'divide the water' (0.12). The lowest centrality index 'sustainable agriculture' (0) is the least mentioned topic by 51 respondents. P3A who administrator did not continue irrigation management the highest centrality index of that is 'sad' (0,12); and 'poor human resource management' (0.12). the lowest centrality index is 'amanah' (0); and 'requires water' (0). As suggested irrigation expert research should focus on traditional irrigation water managemet system, particulary the motivation of P3A administrator to continue or not continu to manage the institution. | |
| 19299 | 25665 | C1B012047 | PENGARUH DISIPLIN KERJA, ETOS KERJA, LOYALITAS, DAN SEMANGAT KERJA TERHADAP KINERJA KARYAWAN(Studi pada Karyawan Eka Sari Catering Purwokerto) | Tujuan penelitian ini adalah untuk menganalisis pengaruh disiplin kerja, etos kerja, loyalitas karyawan dan semangat kerja terhadap kinerja karyawan Eka Sari Catering Purwokerto. Jenis penelitian ini adalah studi kasus dengan menggunakan metode survei pada karyawan Eka Sari Catering Purwokerto. Berdasarkan rumus Slovin, maka ukuran sampel ditentukan sebanyak 40 responden dengan metode pengambilan sampel menggunakan simple random sampling. Selanjutnya, teknik analisis data dalam penelitian ini menggunakan analisis regresi berganda. Berdasarkan hasil analisis data, maka dapat diambil kesimpulan bahwa disiplin kerja, etos kerja maupun loyalitas karyawan mempunyai pengaruh yang positif signifikan terhadap kinerja karyawan Eka Sari Catering Purwokerto, sedangkan semangat kerja tidak mempunyai pengaruh yang signifikan terhadap kinerja karyawan Eka Sari CateringPurwokerto. Mengacu pada kesimpulan tersebut, makadapat diimplikasikan bahwa sebagai upaya untuk terus meningkatkankinerja para karyawannya, pihak manajemen Eka Sari Catering Purwokertoperlu memprioritaskan kebijakan yang terkait dengan disiplin kerja,etos kerja dan loyalitas karyawan. Cara yang dapat dilakukan diantaranya adalah dengan terus meningkatkan kesadaran para karyawan mengenai pentingnya sikap saling menghormati dan saling menghargai antar sesama karyawan, meningkatkan kepatuhan dan ketaatankaryawan terhadap peraturan-peraturan yang berlaku terkait dengan pelaksanaan pekerjaan, membangun hubungan kerja yang didasarkan pada nilai-nilai kejujuran, profesional, kompetensi dan berorientasi pada produktivitas kerja, memenuhi berbagai kebutuhan dan harapan-harapan para karyawan terkait dengan pelaksanaan tugas maupun pekerjaan mereka secara efektif dan efisien serta menciptakan suasana kerja yang nyaman dan aman bagi para karyawan dalam melaksanakan setiap tugas maupun pekerjaan yang dibebankan kepada mereka. | This research was entitled “THE EFFECT OF JOB DISCIPLINE, WORK ETHIC, LOYALTY AND WORK SPIRIT ON EMPLOYEES’ JOB PERFORMANCE (Study on Employees of Eka Sari Catering Purwokerto)”. The aims of this research were to find out the effect of job discipline, work ethic, employees’ loyalty and work spirit on employees’ job performance of Eka Sari Catering Purwokerto.Type of this research was case study by using survey method. Based on the result of Slovin formula, sample size was determined of 40 respondents with sampling method uses simple random sampling. Furthermore, technique of data analysis within study uses multiple regression analysis.Based on the result of multiple regression analysis, it can be concluded that job discipline, work ethic as well as employees’ loyalty has a positive and significant effect on employees’job performance of Eka Sari Catering Purwokerto, while work spirit has no a significant effect on employees’job performance of Eka Sari Catering Purwokerto. Referred to these conclusions, it can be implied that as an effort to continuously improve its employees’ job performance, management of Eka Sari Catering Purwokertoneeds to prioritize the various policies related to work discipline, work ethic and employee loyalty. The ways that could be done by continuing to increase the employees’ awareness about the importance of mutual respect and increase the mutual respect among fellow employees, improving the compliance with applicable regulations related to the implementation of work, build the work relationships based on the values of honesty, professionalism, competence and work-oriented orientation, fulfilling the various needs and expectations of employees related to the implementation of tasks and their work effectively and efficiently, create a comfortable and safe work atmosphere for employees in carrying out each task as well as the work was charged to them. | |
| 19300 | 22538 | D1E013251 | HUBUNGAN VOLUME AMBING DENGAN PRODUKSI SUSU SAPI PERAH FRIESIAN HOLSTEIN (FH) DI BBPTU-HPT BATURRADEN | Penelitian ini bertujuan untuk mengetahui hubungan volume ambing dengan produksi susu sapi perah Friesian Holstein (FH) di BBPTU-HPT Baturraden. Materi yang digunakan dalam penelitian adalah 50 ekor ternak sapi perah FH laktasi 1, data hasil pengukuran volume ambing, dan data catatan produksi susu harian selama 1 periode laktasi. Alat yang digunakan adalah alat ukur berupa metline untuk mengukur panjang, lebar, dan tinggi ambing sebagai dasar pengukuran volume ambing. Penelitian dilakukan menggunakan metode survei. Peubah yang diukur adalah volume ambing dan produksi susu. Hasil penelitian menunjukkan rata-rata produksi susu sebesar 3.554,77 + 912,94 liter/laktasi. Hasil analisis secara regresi dan korelasi menunjukkan rendahnya hubungan antara volume ambing dengan produksi susu dengan nilai koefisien korelasi sebesar 0,244. Hasil analisis regresi menunjukkan adanya hubungan negatif diantara kedua variabel yang ditunjukkan dengan adanya penurunan produksi susu sebesar 0,034 liter pada setiap peningkatan 1 skala volume ambing. Berdasarkan hasil penelitian dapat disimpulkan bahwa besar kecilnya volume atau ukuran ambing tidak berpengaruh terhadap jumlah produksi susu yang dihasilkan. | This resesrch was aims to determine the relationship of udder volume with milk production of Friesian Holstein (FH) dairy cattle in BBPTU-HPT Baturraden. The material used in the resesrch was 50 dairy cattle lactation 1, udder volume measurement, and daily milk production record for 1 lactation period. The instrument used is a measuring instrument in the form of a metline to measure the length, width, and height of the udder as a basis for measuring udder volume. The resesrch was conducted by survey methods. The measured variables are udder volume and milk production. The results showed an average of milk production is 3,554.77 + 912.94 liters/lactation. Regression and correlation analysis results showed a low relationship between udder volume and milk production with a correlation coefficient of 0.244. The results of regression analysis showed a negative relationship between the two variables as indicated by a decrease in milk production of 0.034 liters at each increase in the udder volume scale. Based on the results of the resesrch it can be concluded that the size of the volume or size of the udder does not affect the amount of milk production produced. |