Artikelilmiahs
Menampilkan 5.001-5.020 dari 50.013 item.
| # | Idartikelilmiah | NIM | Judul Artikel | Abstrak (Bhs. Indonesia) | Abtrak (Bhs. Inggris) | |
|---|---|---|---|---|---|---|
| 5001 | 14818 | A1H012073 | ANALISIS EKSERGI FLUID SOLAR THERMAL STORAGE MENGGUNAKAN PHASE CHANGE MATERIAL (PCM) ORGANIK PADA KONSENTRATOR SURYA TIPE PARABOLA | Energi surya merupakan sumber energi terbarukan yang berjumlah besar dan potensial untuk memenuhi kebutuhan energi dalam kehidupan. Kekuatan intensitas radiasi matahari rata-rata di Indonesia adalah 4,8 kWh/m2 membuat energi surya memiliki potensi untuk dimanfaatkan. Masalah utama pada pemanfaatan energi surya yaitu mempertahankan kalor saat cahaya matahari meredup dan hilang, untuk itu diperlukan bahan yang memiliki kapasitas panas jenis tinggi untuk mempertahankan kalor yang tersimpan yaitu Fluid Solar Thermal Storage (FSTS) menggunakan Phase Change Material (PCM) organik. Penelitian ini bertujuan untuk 1) Menganalisis kesetimbangan eksergi pada sistem konsentrator surya tipe parabola Fluid Solar Thermal Storage (FSTS), 2) Menganalisis efisiensi eksergi pada sistem konsentrator surya tipe parabola dan Fluid Solar Thermal Storage (FSTS) dengan menggunakan Phase Change Material (PCM) organik, 3) Menghitung kapasitas panas maksimum yang dapat disimpan pada Phase Change Material (PCM) organik. Analisis data yang digunakan pada penelitian ini menggunakan analisis data kuantitatif dengan mencari dan membandingkan hubungan antara dua variabel, yaitu intensitas cahaya matahari yang diterima dengan perubahan suhu pada sistem konsentrator surya tipe parabola dan Fluid Solar Thermal Storage (FSTS) terhadap waktu dan melakukan perhitungan perpindahan panas yang terjadi pada setiap titik pengukuran dan perhitungan kesetimbangan eksergi dan efisiensi eksergi pada sistem. Hasil penelitian menunjukkan bahwa efisiensi eksergi rata-rata yang diperoleh dari sistem 1 adalah sebesar 25,05% dengan QH diperoleh sebesar 851,35 W, QW diperoleh sebesar 401,77 W, QL diperoleh sebesar 497,21 W. Besarnya nilai entropi rata-rata adalah 10,18 J/kg. Nilai eksergi pada perhitungan ruas kanan dan kiri memiliki selisih yang tidak terlalu besar yaitu 49,42 W. Efisiensi eksergi rata-rata yang diperoleh dari sistem 2 adalah sebesar 26,66% dengan QH sebesar 713,81 W, QW sebesar 190,45 W, QL sebesar 136,63 W. Nilai entropi (∆S) rata-rata sebesar 10,21 J/kg. Nilai eksergi antara perhitungan ruas kanan dan kiri memiliki selisih yang cukup besar yaitu 105,62 W. Panas maksimum yang tersimpan pada PCM organik (paraffin wax) sebesar 600160 Joule pada suhu 39,8 oC dengan iradiasi surya sebesar 1060 W/m2. | Solar energy is a renewable energy source and a large potential to meet energy needs in life. The power intensity of the solar radiation on average in Indonesia is 4.8 kWh/m2 makes solar energy has the potential to be harnessed. Solar thermal energy utilization can be done by using a solar concentrator system. However, the main issue on utilization of solar energy that is maintaining the heat when the Sun's light dimmed and disappears. For solving these problems, needed a material that has a high type of heat capacity to retain heat stored i.e. Fluid Solar Thermal Storage (FSTS) using the organic Phase Change Material (PCM). The purpose of this research are 1) Analyze the exergy equilibrium on solar concentrator parabolic type and Fluid Solar Thermal Storage (FSTS), 2) Analyze the efficiency of a solar concentrator parabolic type and Fluid Solar Thermal Storage (FSTS) using organic Phase Change Material (PCM), 3) Calculate the maximum heat capacity that can be stored on a Fluid Solar Thermal Storage (FSTS). The analyze of the data used in this study using quantitative data analysis by searching and comparing the relationship between two variables, i.e., the intensity of the sunlight received by the change of temperature in systems of solar concentrator parabolic type and Fluid Solar Thermal Storage (FSTS) with respect to time and do the calculation the heat transfer which occurs at every point of the measurement and the calculation of equilibrium and efficiency of exergy on the system.The results showed that The exergy efficiency average of system 1 are 25.05% with QH= 851,35 W, QW= 401,77 W, QL= 497,21 W. Values of entropy (∆S) average of 10,18 J/kg. The value of exergy in the calculation of the right and left sections have a difference which is not too big i.e. 49,42 W. The exergy efficiency average of system 2 are 26,66% with QH amounted to 713,81 W, QW= 190,45 W, QL 136,63 W. Values of entropy (∆S) average of 10,21 J/kg. The value of exergy between the calculation of the right and left sections have a difference large enough i.e. 105,62 W. The maximum heat stored of the PCM (paraffin wax) of 600160 Joule at 39,8 oC with the solar irradiation of 1060 W/m2. | |
| 5002 | 14819 | A1H012038 | PENGARUH EDIBLE COATING BERBAHAN DASAR LIDAH BUAYA (Aloe vera L.) DENGAN LAMA PENCELUPAN YANG BERBEDA TERHADAP PERUBAHAN FISIOLOGI PADA MANGGA ARUM MANIS (Mangifera indica L.) SELAMA PENYIMPANAN | Mangga termasuk buah yang mempunyai umur simpan pendek dan mudah rusak, karena setelah dipanen buah akan mengalami perubahan-perubahan kimia. Beberapa cara untuk mempertahankan kualitas dan kesegaran buah serta memperpanjang umur simpan selain dengan mengubah buah mangga menjadi produk olahan industri yaitu dengan cara menyimpan buah pada ruang pendingin (suhu rendah), pada ruang bertekanan dan modifikasi atmosfer kemasan serta mengaplikasikan edible coating. Penelitian ini bertujuan untuk: 1) Mengetahui pengaruh edible coating berbahan dasar lidah buaya terhadap perubahan fisiologi buah mangga arumanis, 2) Mengetahui waktu pencelupan edible coating yang tepat untuk mempertahankan mutu mangga arumanis. Metode yang digunakan dalam penelitian ini adalah uji statistika dengan kinetika perubahan mutu. Faktor-faktor yang digunakan adalah waktu pencelupan, yaitu tanpa pencelupan, 3 menit, 5 menit, 7 menit, dan konsenterasi CMC, yaitu 0%, 1% disimpan pada suhu ruang serta suhu rendah. Hasil yang didapatkan dari penelitian ini umur simpan mangga arumanis berpengaruh terhadap warna, kadar brix, kekerasan, susut bobot. Hasil organoleptik terhadap mangga arumanis berpengaruh pada parameter warna, tekstur, aroma, rasa sampai penyimpanan 20 hari masih bisa diterima oleh penelis secara umum. Berdasarkan data penelitian, perlakuan C1L5K2T (CMC 1% dengan lama pencelupan 5 menit dan disimpan pada suhu rendah) adalah perlakuan terbaik secara keseluruhan. | Mango is fruit has a short shel life and kind of perishable fruit, fruit will experienced a chemical changes. Another ways to hold the quality and the freshness of the fruit and to extend shelf life than by changing the mango into refined product industry that is by storing the fruit in cold storage (low temperature), the pressure chamber and modified atmosphere packaging and applying edible coating. This research was aimed: 1) To know the effect of edible coating made from aloe vera to changes in the physiology of arumanis mango, 2) To know time for dyeing edible coating is best to maintain the quality of arumanis mango. Method used in this research is statistics test with the kinetics of quality changes. The factors used are dyeing time, the treats are without dyeing time, 3 minutes, 5 minutes, 7 minutes, and the CMC concentration is 0%, 1% and stored at room temperature and low temperature. The result showed from research is the shelf life of arumanis mango affect the color, brix levels, hardness, weight loss. The result of organoleptic toward arumanis mango affect the color, texture, flavor, taste to the storage for 20 days are accepted by penelists in general. Based on data from the research, treatment C1L5K2T (CMC 1% (with 5 minutes dyeing time and stored at low temperature) is the best treatment overall. | |
| 5003 | 14820 | A1H012049 | ANALISIS ENERGI FLUID SOLAR THERMAL STORAGE MENGGUNAKAN PHASE CHANGE MATERIAL (PCM) ORGANIK PADA KONSENTRATOR SURYA TIPE PARABOLA | Energi surya merupakan salah satu energi terbarukan yang sudah mulai dikembangkan di Indonesia, terbukti dengan adanya pemanfaatan teknologi seperti sel surya, water heater, kompor surya dan lain-lain di berbagai wilayah Indonesia. Adapun pemanfaatan secara tradisional telah dilakukan masyarakat sejak dulu contohnya untuk proses pengeringan bahan. Kendala yang dialami dalam pemanfaatan energi matahari yaitu pada saat radiasi rendah yaitu pada saat musim penghujan, atau pada saat mendung maka energi matahari tidak dapat dijadikan sebagai sumber energi terbarukan. Oleh karena itu dilakukan penelitian Solar Thermal Storage (STS) dengan menggunakan parafin sebagai Phase Change Material (PCM) organik. Adapun manfaat dari penelitian ini yaitu agar energi matahari sebagai energi terbarukan dapat termanfaatkan pada saat kondisi tidak terdapat radiasi matahari seperti pada saat hujan dan mendung. Tujuan dari penelitian ini terdiri dari (1) mengetahui efisiensi energi pada sub sistem konsentrator surya tipe parabola dan sub sistem solar thermal storage (STS), (2) mengetahui kapasitas maksimum panas yang dapat disimpan oleh parafin sebagai Phase Change Material (PCM) organik, (3) mengetahui kesetimbangan energi pada sub sistem konsentrator surya tipe parabola dan sub sistem solar thermal storage. Penelitian dilakukan dengan cara pengukuran beberapa titik pengukuran yang telah ditentukan sesuai dengan kebutuhan analisis data. Pengukuran data diambil dengan menggunakan beberapa alat seperti hybrid recorder, thermocouple, termometer infrared, hygrometer, dan anemometer. Pengambilan data dilakukan setiap 5 menit sekali dari pukul 08.00–16.00 WIB dengan 5 kali ulangan. Analisis data dilakukan dengan menggunakan persamaan-persamaan matematis berdasarkan referensi yang sesuai. Penelitian dilaksanakan pada musim penghujan, sehingga hasil yang didapatkan kurang maksimal. Penelitian bertempat di depan Laboratorium Teknologi Pertanian. Efisiensi energi sub sistem konsentrator surya parabola dan sub sistem Solar Thermal Storage (STS) masing-masing sebesar 3,399 % dan 1,167 %. Kapasitas panas yang dapat disimpan parafin yaitu dalam bentuk panas sensibel dengan nilai terbesar adalah 180,4 joule pada saat radiasi 30 W/m2 dengan temperatur parafin 31,5 °C pada waktu pengukuran pukul 15:55 WIB. Kesetimbangan energi pada sub sistem konsentrator parabola menghasilkan nilai Est atau energi yang tersimpan dalam sub sistem sebesar 52,630 Watt. Reaksi perpindahan panas terjadi secara eksoterm, yaitu laju perpindahan panas berpindah dari sistem ke lingkungan. Sedangkan kesetimbangan energi pada sub sistem Solar Thermal Storage (STS) menghasilkan nilai Est atau energi yang tersimpan dalam sub sistem sebesar 81 Watt. Reaksi perpindahan panas terjadi secara endoterm, yaitu laju perpindahan panas berpindah dari lingkungan ke sistem. | Solar energy is one of the renewable energy which has already started to be developed in Indonesia, as evidenced by the existence of the utilization of technology like solar cells, water heater, solar cookers and others in various parts of Indonesia. As for the utilization of traditional society has done since the first example for the drying process of materials. Constraints experienced at the moment of harnessing solar energy that is at the time of the rainy season, or at the time the light rain and no radiation is then the energy of the Sun can not serve as a source of renewable energy. Therefore conducted research solar thermal storage using paraffin as the organic phase change material. As for the output of the research so that solar energy as a renewable energy can be use at a time when there is no solar radiation conditions such as on a rainy and cloudy. The purpose of this research consists of (1) find out the energy efficiency on a solar concentrator type parabolic sub system and solar thermal systems and storage sub system, (2) find out the maximum capacity of the heat can be stored by paraffin as the organic phase change materials (PCM), (3) find out the equilibrium energy on solar concentrator type parabolic sub system and solar thermal and storage sub system. Research done by measuring several point measurement have been determined in accordance with the needs of the data analysis. Measurement data taken using some tools such as hybrid recorders, thermocouple, infrared thermometer, anemometer, and higrometer. Data retrieval is done once every 5 minutes from 08.00 – 16.00 PM with repeats 5 times. Data analysis was done using mathematical equations based on appropriate reference. The research was carried out on the rainy season, so that the results obtained are not maximum. Research located in front of the laboratory of agricultural technology. Efficiency energy of solar parabolic concentrator sub system and solar thermal storage sub system each of 3.399% and 1.167%. Heat capacity of paraffin can be stored in form sensibel heat of is the largest value 180.4 joule at the moment radiation 30 W/m2 with the paraffin temperature 31.6 °C at the time of the measurements of 3.55 p.m.. Equilibrium energy on parabolic concentrator sub systems produce a value Est or energy stored in the sub systems of 56.630 Watts. Reaction heat transfer occurs in eksoterm, namely the rate of heat transfer from the system to the environment. While the energy equilibrium in the sub systems of solar thermal storage generates the Est value or energy stored in the sub systems amounting to 81 Watts. Reaction heat transfer occurs in endoterm, namely the rate of heat transfer from the environment to the system. | |
| 5004 | 14821 | F1G012018 | Analisis Kepribadian Tokoh Utama Novel Seperti Dendam Rindu Harus Dibayar Tuntas Karya Eka Kurniawan | RINGKASAN Penelitian ini berjudul “Analisis Kepribadian Tokoh Utama Novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan”. Penelitian ini bertujuan untuk mendeskripsikan struktur novel dan kepribadian tokoh utama novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan dengan mengunakan pendekatan Psikologi sastra. Penelitian ini lebih memfokuskan kepribadian tokoh utama yaitu Ajo Kawir. Data dalam penelitian ini adalah novel Seperti Dendam Rindu Harus Dibayar Tuntas yang akan dianalisis, serta data pendukung sebagai alat untuk menganalisis. Teknik pengumpulan data yaitu dengan cara membaca keseluruhan isi novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan, mencatat bagian-bagian yang penting dari novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan, dan mengklasifikasikan data-data yang di dapat sesuai dengan rumusan masalah. Kemudian, teknik analisis data yaitu dengan cara mendeskripsikan struktur yang membangun novel seperti tokoh dan penokohan, plot, dan latar/setting yang ada pada novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan, mendeskripsikan kepribadian tokoh utama novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan, dan menyimpulkan hasil analisis novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan sesuai dengan rumusan masalah. Hasil penelitian novel Seperti Dendam Rindu Harus Dibayar Tuntas karya Eka Kurniawan dengan pendekatan psikologi sastra dapat diketahui kepribadian tokoh utama pada dasarnya memiliki watak yang baik, rajin, bertanggung jawab, tangguh, dan menghargai wanita. Namun karena trauma di masalalu dan keputusasaan terhadap kondisi penisnya yang tidak bisa ereksi, membuat Ajo Kawir tidak bersikap seperti dirinya. Ajo Kawir menjadi pesimis, mudah marah, keras kepala, dan mudah menangis. Ia cenderung melampiaskan keputusasaanya kepada orang lain dan bersikap sesuai dengan id dan egonya. Tidak ada keseimbangan antara id, ego, dan super ego yang dialami Ajo Kawir. Ajo Kawir cenderung mementingkan prinsip kenikmatan daripada aspek sosiologis yang berkembang di Masyarakat, sehingga terjadi ketegangan di dalam diri atau pribadi Ajo Kawir. | SUMMARY This research titled "The Analysis of Personality of the Main Character in Seperti Dendam Rindu Harus Dibayar Tuntas Novel by Eka Kurniawan". The purpose of this research are to describe the novel's structure and the personality of the main character in Seperti Dendam Rindu Harus Dibayar Tuntas by Eka Kurniawan. This research focus on Ajo Kawir as the main character. The data in this research were Seperti Dendam Rindu Harus Dibayar Tuntas novel and other sources to analyze the novel. Technique in collecting data were reading carefully Seperti Dendam Rindu Harus Dibayar Tuntas novel by Eka Kurniawan, noting the important things in the novel, and classifying the data to answer the research questions. The technique in data analysis were describing the structure of the novel like character, characterization, setting, and plot of Seperti Dendam Rindu Harus Dibayar Tuntas novel by Eka Kurniawan, describing the personality of the main character in the Seperti Dendam Rindu Harus Dibayar Tuntas novel, and concluding the result of analysis of Seperti Dendam Rindu Harus Dibayar Tuntas by Eka Kurniawan that appropriate with the research questions. The result of the research showed that the personality of the main character in Seperti Dendam Rindu Harus Dibayar Tuntas by Eka Kurniawan was actually a nice person, responsible, strong, and nice to the women. However, because of his traumatic experiences in the past and bad condition of his penis, made him change his attitude. Ajo Kawir became a pessimistic person, angrier person, stubborn person, and maudlin. He wreaked his despair to the other person and acted based on his id and ego. Ajo Kawir did not have a balanced id, ego, and superego. Ajo Kawir tended to choose the pleasure than the sociological aspect in the society, so there was not a balanced personality in Ajo Kawir. Keywords: Psychology of Literature, Personality, Novel. | |
| 5005 | 14822 | C1B012050 | ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI STRUKTUR MODAL PADA PERUSAHAAN SEKTOR PARIWISATA, RESTORAN DAN HOTEL YANG TERDAFTAR DI BURSA EFEK INDONESIA | Penelitian ini berjudul “Analisis Faktor-Faktor Yang Mempengaruhi Struktur Modal Pada Perusahaan Sektor Pariwisata, Restoran Dan Hotel Yang Terdaftar Di Bursa Efek Indonesia“. Tujuan penelitian ini adalah untuk menganalisis pengaruh ukuran perusahaan, profitabilitas, pertumbuhan perusahaan, dan likuiditas terhadap struktur modal pada sektor pariwisata, restoran dan hotel. Populasi dalam penelitian ini adalah semua perusahaan yang terdaftar di BEI yang pada periode 2010-2014. Jumlah sampel yang diambil dalam penelitian ini adalah 11 perusahaan dengan menggunakan Purposive sampling method. Teknik analisis data dalam penelitian ini menggunakan regresi linear berganda, uji-t, uji-F dan koefisien determinasi. Data yang digunakan berupa data kuantitatif dengan sumber perolehan data sekunder. Berdasarakan hasil penelitian menunjukkan bahwa: (1) ukuran perusahaan berpengaruh positif dan signifikan terhadap struktur modal, (2) Profitabilitas tidak berpengaruh terhadap struktur modal, (3) Pertumbuhan Perusahaan berpengaruh positif dan signifikan terhadap struktur modal, (4) likuiditas berpengaruh negatif dan signifikan terhadap struktur modal. Impilikasi dari kesimpulan penelitian ini yaitu dalam upaya memperoleh struktur modal yang optimal, pihak manajemen sebaiknya memperhatikan berbagai faktor yang mempengaruhi struktur modal yaitu ukuran perusahaan, pertumbuhan perusahaan, dan likuiditas. Upaya yang dapat dilakukan adalah dengan menyeimbangkan antara hutang dengan modal sendiri untuk operasional perusahaan. | This study entitled "Analysis of Factors Influencing Capital Structure On Tourism Companies, Restaurants and Hotels sectors Listed on the Indonesia Stock Exchange". The purpose of this study was to analyze the influence of firm size, profitability, growth, and liquidity of the capital structure in the tourism, restaurants and hotels sectors. The population in this study are all companies listed on the Stock Exchange year 2010-2014 periode. The number of samples taken in this study were 11 companies by using purposive sampling method. Data analysis techniques in this study are multiple linear regression, t-test, F-test and coefficient of determination. Data used in this research are the secondary data sources. Methods of data collection using literature, and documentation. Based on the results of the study show that: (1) the size of the company's has positive and significant influence on the capital structure, (2) Profitability has no influence on the capital structure, (3) The Company's Growth has positive and significant influence on the capital structure, (4) liquidity has significant negative influence on the capital structure. The implications of this study are in an effort to obtain an optimal capital structure, the management should take into account the various factors affecting capital structure which are firm size, the company's growth, and liquidity. One of the solusion is balancing between equity and debt for firm operational. | |
| 5006 | 14823 | G1A012097 | DETEKSI GEN APC PADA DAERAH EKSON 15 DARI JARINGAN DALAM FIKSATIF FORMALIN : Studi pada Tikus (Rattus norvegicus) Galur Wistar yang dipapar Asap Kretek | Latar belakang : Merokok telah menjadi gaya hidup bagi sebagian orang. Sebagian besar rokok yang dikonsumsi oleh orang Indonesia adalah rokok jenis kretek. Rokok secara umum mengandung 7000 bahan kimia yang sebagian besar merupakan bahan karsinogenik. Paparan bahan karsinogenik dari rokok dalam jangka waktu yang panjang dapat menyebabkan mutasi beberapa gen. Salah satu gen yang menjadi kunci dalam supresi tumor adalah gen APC. Mutasi gen APC ditemukan dalam 60% adenoma. Target mutasi pada gen APC adalah di daerah ekson 15, sekaligus merupakan ekson terbesar pada gen APC. Penelitian tentang deteksi gen APC pada daerah ekson 15 dianggap penting, untuk melengkapi studi tentang tikus (Rattus norvegicus) galur Wistar. Sediaan fiksatif formalin dipilih karena belum ada penelitian sebelumnya. Studi ini sekaligus dilakukan untuk menilai positivitas gen APC pada fiksatif formalin menggunakan metode PCR. Tujuan : Tujuan dari penelitian ini adalah untuk mendeteksi dan mengetahui positivitas gen APC di ekson 15 pada jaringan fiksatif formalin dengan metode PCR, diharapkan hasil yang didapat dapat melengkapi studi tentang tikus (Rattus norvegicus) galur Wistar yang dipapar asap kretek. Metode Penelitian : Penelitian ini menggunakan metode deskriptif dengan pendekatan potong lintang (cross sectional). Peneliti menggunakan jaringan fiksatif formalin tikus (Rattus norvegicus) Galur Wistar, berjumlah 20 sampel. Dilakukan dengan metode PCR menggunakan primer spesifik left 5’- TGCATCA TGGAAAGATACGTG -3’ dan right 5’- GTCTGGCTCCGGTAAGTGAG -3’ berukuran 276 pb. Hasil : Deteksi DNA gen APC ditemukan positif pada 4 dari 20 sampel. Kesimpulan : Gen APC dapat terdeteksi pada fiksatif formalin menggunakan metode PCR dan positivitasnya adalah 20%. | Background : Smoking has become a lifestyle for some people. Most of the cigarettes consumed by the people of Indonesia are kretek cigarettes. Cigarettes generally contain 7,000 chemicals which are largely carcinogenic material. Exposure to carcinogenic substances from cigarettes in a long period of time can cause mutations in several genes. One gene as tumor suppressor is the APC gene. APC gene mutation was found in 60% of adenomas. Targeted mutation of the APC gene is in the region of exon 15 and it is the largest exon in the gene. Research on the detection of APC gene at exon 15 is considered as an important study and to complete a study on rats ( Rattus norvegicus ) Wistar strain. Preparations of formalin fixative are selected because no previous studies have been found. This study was performed to assess the positivity of the APC gene in formalin fixative using PCR methods. Goal : The purpose of this study was to detect and determine the positivity of APC gene in exon 15 of the formalin fixated tissue by PCR. The results obtained were expected to complement the study on rats ( Rattus norvegicus ) Wistar strain exposed to kretek smoke. Method : This research used a descriptive method with cross sectional approach. Researchers used a formalin fixated tissue of rats ( Rattus norvegicus ) Wistar strain with a total of 20 samples. Performed by PCR using specific primers 5' left TGCATCATGGAAAGATACGTG-3 ' and 5' right GTCTGGCTCCGGTAAGTGAG -3" size of 276 bp. Result : DNA detection of APC gene was found positive in 4 of 20 samples. Conclusion : APC gene can be detected in formalin fixated tissue using the PCR method and its positivity was 20 % . | |
| 5007 | 14702 | H1D011049 | ESTIMASI BIAYA KONSEPTUAL PADA PEMBANGUNAN JEMBATAN BETON BERTULANG | Estimasi biaya konseptual merupakan tahap awal perencanaan sebuah proyek konstruksi. Estimasi ini memberikan gambaran besarnya anggaran yang harus dikeluarkan untuk suatu proyek konstruksi. Penelitian ini bertujuan untuk mendapatkan model estimasi biaya konseptual jembatan dengan menggunakan metode indeks biaya bangunan. Indeks biaya bangunan jembatan merupakan angka yang menunjukan biaya per m2 jembatan pada waktu tertentu. Data yang digunakan dalam penelitian ini adalah dokumen kontrak dan gambar rencana jembatan beton bertulang dengan bentang 4,5 meter sampai dengan 38,8 meter dan lebar jembatan 2 meter sampai dengan 7 meter dengan fondasi sumuran yang dibangun pada tahun 2012 – 2015 di wilayah eks Karesidenan Banyumas. Data penelitian ini berasal dari Dinas Bina Marga dan Dinas Pekerjaan Umum di wilayah eks Karesidenan Banyumas. Hasil dari penelitian ini menunjukan bahwa model estimasi biaya per m2 komponen pekerjaan utama untuk struktur atas adalah BJ(SA)i= 539.014.259,40ln(x)- 4.097.321.287,86, komponen pekerjaan struktur bawah adalah BJ(SB)i= 429.671.279,44ln(x) – 3.263.040.593,22, dan untuk komponen pekerjaan oprit adalah BJ(O)i = 262.248.918,65ln(x) – 1.994.055.103,77, dengan x = Tahun. Nilai error hasil pengujian validasi model ini adalah 6,39%. | The estimated cost is the first stage of conceptual planning of a construction project. This estimation is an overview of the magnitude of the budget that must be issued for a construction project. This research aims to gain conceptual cost estimation model of the bridge by using building cost index method. Bridge cost index is a value that shows cost per m2 of the bridge at a certain period of time. The data used in this research is contract bridge plans and shop drawings of reinforced concrete with length 4,5 meters until 38,8 meters and width 2 meters until 7 meters using the caisson foundation which built in 2012 – 2015 in the area of Banyumas Regency. Research data comes from the Bina Marga and public works in the area of Banyumas Regency. The results of this research show model estimates the cost per m2 component of the main work for the upper structure is BJ (SA) i =539.014.259,40 ln(x) – 4.097.321.287,86, components of bottom structure is BJ (SB) i = 429.671.279,44 ln (x)-3.263.040.593,22 , and to the components of the job oprit is BJ (O)i = 262.248.918,65ln(x) - 1.994.055.103,77, with x = year. The value of the error test results the validation of this model is 6,39%. | |
| 5008 | 14824 | C1E008086 | PENGARUH KEPRIBADIAN, KECERDASAN EMOSI DAN KECERDASAN SPIRITUALITAS TERHADAP KINERJA GURU SMP NEGERI 1 KARANGLEWAS KABUPATEN BANYUMAS | Penelitian ini mengambil judul Pengaruh Kepribadian, Kecerdasan Emosi Dan Kecerdasan Spritualitas Kerja Terhadap Kinerja Guru SMP Negeri 1 Karanglewas Kabupaten banyumas sebagai objek. Tujuan penelitian ini adalah yang pertama untuk mengetahui pengaruh kepribadian terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, kedua untuk mengetahui pengaruh kecerdasan emosi terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, ketiga untuk mengetahui pengaruh kecerdasan spritualitas berpengaruh terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, dan keempat untuk mengetahui variabel mana diantara variabel kepribadian, kecerdasan emosi dan kecerdasan spritualitas yang mempunyai pengaruh paling besar terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas. Hipotesis yang diajukan pertama kepribadian mempunyai pengaruh terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, kedua kecerdasan emosi mempunyai pengaruh terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, ketiga kecerdasan spritualitas mempunyai pengaruh terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, dan kecerdasan emosi mempunyai pengaruh yang paling besar terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas Penelitian dilakukan dengan menggunakan metode studi kasus, dilakukan di SMP Negeri 1 Karanglewas Kabupaten Banyumas. Untuk mengetahui signifikansi pengaruh kepribadian, kecerdasan emosi dan kecerdasan spritualitas secara bersama-sama terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas digunakan uji F. Untuk mengetahui signifikansi pengaruh kepribadian, kecerdasan emosi dan kecerdasan spritualitas secara parsial terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas digunakan Uji t. Untuk mengetahui variabel yang mempunyai pengaruh lebih besar terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas, digunakan uji elastisitas. Berdasarkan pada hasil analisis dan pembahasan pada penelitian ini dapat diambil kesimpulan bahwa hipotesis yang menyatakan kepribadian mempunyai pengaruh terhadap kinerja guru diterima. Berdasarkan uji F diperoleh nilai F hitung lebih besar dari F-tabel dan nilai t hitung lebih besar dari nilai t tabel. Hipotesis yang menyatakan kecerdasan emosi mempunyai pengaruh terhadap kinerja guru, diterima. Berdasarkan uji F diperoleh nilai F hitung sebesar lebih besar dari F-tabel , sedang nilai t hitung lebih besar dari nilai t tabel. Hipotesis yang menyatakan kecerdasan spritualitas mempunyai pengaruh terhadap kinerja guru, diterima. Berdasarkan uji F diperoleh nilai F hitung lebih besar dari F-tabel, sedang berdasarkan uji t diperoleh t hitung lebih besar dari nilai t tabel. Hipotesis yang menyatakan Kecerdasan emosi mempunyai pengaruh yang paling besar terhadap kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas diterima. Hal ini dibuktikan dengan uji elastisitas yang menghasilkan nilai kecerdasan emosi lebih besar dibandingkan nilai variabel kepribadian, dan Kecerdasan Spiritual (0,4537 > 0,3207 dan 0,0450). Implikasi, kepribadian, kecerdasan emosi dan kecerdasan spiritual sudah cukup baik namun perlu ditingkatkan lagi agar kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas semakin baik. Kinerja guru pada SMP Negeri 1 Karanglewas Kabupaten Banyumas sudah cukup baik namun perlu ditingkatkan lagi melalui pendidikan formal maupun non formal, mengikuti diklat dan workshop dilaksanakan oleh Kementerian Pendidikan baik ditingkat Kabupaten, Provinsi maupun Pusat Kata kunci : kepribadian, kecerdasan emosi, kecerdasan spritualitas kerja, kinerja guru | This research took the title Influence of Personality , Emotional Intelligence and Intelligence Working Toward Spirituality Teacher Performance SMP Negeri 1 Karanglewas Banyumas regency as an object . The purpose of this study is the first to investigate the influence of personality on teacher performance on SMP Negeri 1 Karanglewas Banyumas, both to determine the effect of emotional intelligence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas, third to determine the effect of intelligence spirituality affect the performance of teachers at junior high school Negeri 1 Karanglewas Banyumas, and the fourth to know which variable among personality variables , emotional intelligence and wit spirituality that has the most effect on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas. The hypothesis was first proposed personality has an influence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas, both emotional intelligence has an influence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas, three intelligence spirituality have an influence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas, and emotional intelligence have the greatest influence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas The study was conducted by using the case study method , performed in SMP Negeri 1 Karanglewas Banyumas. To determine the significance of the influence of personality , emotional intelligence and wit spirituality together on teacher performance on SMP Negeri 1 Karanglewas Banyumas used F test to determine the significance of the influence of personality , emotional intelligence and wit spirituality partially on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas used t test . To determine the variables that have a bigger impact on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas, elasticity test was used . Based on the analysis and discussion in this study can be concluded that the hypothesis that personality has an influence on teacher performance acceptable. Based on F test obtained F count larger than F-table and the value of t is greater than t table. Hypothesis that emotional intelligence has an influence on teacher performance, acceptable. Based on F test obtained F count of greater than F-table, while the value of t is greater than t table. Intelligence hypothesis that spirituality has an influence on teacher performance, acceptable. Based on F test obtained F count larger than F-table, were based on t test obtained t is greater than t table. Hypothesis that emotional intelligence has the greatest influence on the performance of teachers at SMP Negeri 1 Karanglewas Banyumas is received. This is evidenced by the elasticity test that produces a value of emotional intelligence is greater than the value of the personality variables, and spiritual intelligence (0.4537> 0.3207 and 0.0450). The implication, personality, emotional intelligence and spiritual intelligence has been quite good, but need to be improved so that the performance of teachers at SMP Negeri 1 Karanglewas Banyumas getting better. Teacher performance on SMP Negeri 1 Karanglewas Banyumas has been quite good, but need to be improved through formal and non formal education, follow the training and workshops conducted by the Ministry of Education both at district, provincial and central Keywords: personality, emotional intelligence, spirituality intelligence work, the performance of teachers | |
| 5009 | 14827 | H1L011051 | RANCANG BANGUN SISTEM INFORMASI SHOWROOM MOBIL BERBASIS WEBSITE (STUDI KASUS SHOWROOM MOBIL INYONG MOTOR) | ABSTRAK RANCANG BAGUN SISTEM INFORMASI SHOWROOM MOBIL BERBASIS WEB STUDI KASUS SHOWROOM MOBIL INYONG MOTOR Sriwanti Showroom Mobil Inyong Motor (SMIM) adalah perusahaan yang bergerak dibidang jual beli mobil bekas, yang menawarkan berbagai jenis mobil, sebagai perusahaan yang sedang berkembang, SMIM berinisiatif untuk menjadikan internet sebagai media pemasaran. Seiring dengan perkembangan teknologi dan bisnis, SMIM mengalami beberapa kendala saat proses pendataan. Seperti data yang berkaitan dengan penjualan belum tercatat dengan rapi, sehingga menyulitkan pemilik showroom dalam melakukan pengecekan data, selain itu keberadaan SMIM yang belum banyak diketahui oleh calon pembeli juga merupakan salah satu kendala yang ada. Dari permasalahan tersebut munculnya gagasan untuk membuat suatu sistem berbasis web, yang dapat membantu penjualan mobil. Sistem ini dibangun menggunakan metode waterfall, menggunakan PHP sebagai bahasa pemrogaman, MYSQL sebagai database sistem, dan black-box testing sebgai metode pengujiannya. User dalam sistem ini dibagi menjadi tiga jenis user, yaitu konsumen, pemilik mobil, admin. Didukung dengan tersedianya jaringan internet, sistem ini mampu menjadi alat bantu pemasaran SMIM. Kata kunci : Showroom inyonk motor (SMIM) | ABSTRACT THE DEVELOPMENT OF WEB BASED CAR SHOWROOM INFORMATION SYSTEM ( CASE STUDY INYONG MOTOR CAR SHOWROOM) Sriwanti Showroom Mobil Inyong Motor (SMIM) as growing business in used car trading that offers several cars has initiative to implement the internet as promotion media. As technologies and business develop, SMIM has obstacles in management proces. Such as the sales data has not well recorded thus it is hampering the show room owner to check the data out, besides SMIM also has not famous. By the obstacles, there is solution to make a web based system, wich help in sale car. The system was built by waterfall method, used PHP as programming language, MYSQL as system database, and black box testing as testing method. Available users on system divided into 3 role, they are consumer, car owner, and admin. Supported by internet availability, the system could be a tool to promote SMIM. Keyword: Showroom Inyonk Motor (SMIM) | |
| 5010 | 14826 | A1L011089 | PENGUJIAN PUPUK N-ZEOLIT-SR DENGAN METODE PELINDIAN DAN APLIKASINYA TERHADAP PERTUMBUHAN PADI SAWAH PADA INCEPTISOL | Salah satu upaya peningkatan pertumbuhan padi sawah pada lahan Inceptisol dapat dicapai dengan memperhatikan ketersediaan unsur hara nitrogen dalam tanah. Aplikasi pupuk N-Zeolit-SR merupakan salah satu alternatif untuk mempertahankan ketersediaan unsur hara nitrogen dalam tanah dan mencegah kehilangan unsur hara nitrogen melalui pencucian oleh air. .Penelitian bertujuan untuk 1) menguji dan menentukan takaran serta ukuran bahan perekat pupuk terbaik melalui pelindian; 2) mengetahui pengaruh takaran pupuk N-Zeolit-SR terhadap pertumbuhan padi sawah pada Inceptisol. Penelitian ini dilaksanakan di screen house Fakultas Pertanian, Universitas Jenderal Soedirman, Karangwangkal, Purwokerto dan di Laboratorium Ilmu Tanah, Fakultas Pertanian, Universitas Jenderal Soedirman, Purwokerto. Penelitian ini berlangsung selama sembilan bulan dan dilaksanakan pada Maret 2015 sampai dengan Desember 2015. Penelitian ini dilakukan dengan Rancangan Acak Kelompok Lengkap (RAKL) dengan 2 faktor untuk pengujian takaran dan ukuran butiran bahan perekat pupuk. Sebagai faktor 1 adalah ukuran butiran pupuk N-Zeolit-SR yang terdiri atas 2 aras yaitu ukuran halus (2-3 mm) dan ukuran kasar (3-4 mm). Sebagai faktor 2 adalah takaran bahan perekat pupuk N-Zeolit-SR yang terdiri dari 6 aras yaitu 0 g/g komposisi pupuk (kontrol), 0,68 g/g komposisi pupuk (AGL1), 1,36 g/g komposisi pupuk (AGL2), 2,05 g/g komposisi pupuk (AGL3), 2,75 g/g komposisi pupuk (AGL4) dan 3,41 g/g komposisi pupuk (AGL5); Rancangan Petak Terbagi (Split Plot) digunakan untuk aplikasinya terhadap pertumbuhan tanaman padi pada lahan Inceptisol. Sebagai petak utama ialah varietas padi sawah (V1 = Varietas Inpari-13, dan V2 = Varietas Ciherang ). Anakan petak ialah takaran pupuk N-Zeolite-SR kelompok terbaik ke-2 hasil uji pelindian yaitu tanpa perlakuan (K2N0), 0,2 g N/polibag (K2N1), 0,4 g N/polibag (K2N2), 0,6 g N/polibag (K2N3), 0,8 g N/polibag (K2N4), dan 1,0 g N/polibag (K2N5). Variabel pertumbuhan yang diamati adalah tinggi tanaman, jumlah daun, jumlah anakan produktif, dan biomassa tanaman, sedangkan variabel pengujian pupuk dengan metode pelindian yang diamati adalah pH-H2O tanah sebelum pelindian, pH-H2O tanah setelah pelindian, pH-H2O air terlindi, DHL tanah sebelum pelindian, DHL tanah setelah pelindian, DHL air terlindi, N-total tanah sebelum pelindian, N-total tanah setelah pelindian dan N-total air terlindi. Aplikasi takaran bahan perekat pupuk N-Zeolit-SR menunjukkan penurunan pH-H20, DHL dan N-total pada tanah setelah pelindian. Aplikasi ukuran butiran pupuk menunjukkan bahwa semakin halus ukuran butiran pupuk, maka semakin mudah tercuci oleh air. Hasil analisis menunjukan bahwa takaran bahan perakat pupuk N-Zeolit-SR pada takaran komposisi Vertisol 2,05 g/g komposisi pupuk merupakan komposisi terbaik pupuk N-Zeolit-SR kelompok terbaik ke-1. Aplikasi pupuk N-Zeolit-SR kelompok terbaik ke-2 pada varietas Inpari-13 merupakan varietas yang memiliki respon pertumbuhan tanaman yang lebih unggul dibandingkan dengan varietas Ciherang. | One of the rice growth improvement efforts on land the Inceptisol is paying attention to the availability of nitrogen nutrient in the soil. Application of N- Zeolite-SR fertilizer is one of alternative to maintain the availability of nitrogen nutrient in the soil and prevent the loss of nitrogen nutrient elements through leaching by water. The research purposed to test and determine the rate and size of the binder, who’s the best fertilizer through leaching; To know how the rate of N-Zeolite-SR fertilizer against rice growth in land Inceptisol. This research was carried out on the agriculture faculty screen house, General Soedirman University, Karangwangkal, Purwokerto and soil laboratory, agriculture faculty, Jenderal Soedirman University, Purwokerto. This research lasted in nine months who was carried out in March, 2015 until Desember 2015. This research was conducted with a Complately Randomise Block Design (CRBD) with two factors for measure testing and adhesive materials grain fertilizer. As a first factor is the size of a grain N-Zeolite-SR fertilizer which consists of two levels i.e. soft size (2-3 mm) and harsh size (3-4 mm). As a second factor is just the ingredient N-Zeolite-SR gluten fertilizer which consists of 6 levels i.e. 0 g/g fertilizer composition (control), 0.68 g/g fertilizer composition (AGL1), 1.36 g/g fertilizer composition (AGL2), 2.05 g/g fertilizer composition (AGL3), 2.75 g/ g fertilizer composition (AGL4) and 3.41 g/g fertilizer composition (AGL5); The Split Plot Design for its application against the paddy rice growth on Inceptisol. As the main plot was rice varieties (V1 = Inpari-13 Variety, and V2 = Ciherang Variety). As a sub-plot was N-Zeolite-SR fertilizer measure who’s the second best block of leaching test result, i.e. without treatment (K2N0), 0.2 g N/polybags (K2N1), 0.4 g N/polybags (K2N2), 0.6 g N/polybags (K2N3), 0.8 g N/polybags (K2N4) and 1.0 g N/polybags (K2N5). The observed growth variable is the plants height, leaves number, productive saplings number, and plants biomass, whereas the testing fertilizer leaching method is observed variable is soils pH-H2O before leaching, soil pH-H2O after leaching, pH-H2O leaching water, soils EC before leaching, soils EC after leachings, EC leaching water, soils N-total before leaching, soils N-total after leaching and N-total leaching water. The measure application of adhesive material N- Zeolite-SR fertilizer can decrease in soils pH-H20, EC and N-total after leaching. The application of the granules size fertilizer shows that the more fertilizer refined size who’s more easily leached by water. The results of the analysis showed that material adhesive N-Zeolite-SR fertilizer with Vertisol composition 2.05 g/g fertilizer composition is the first best group of the N-Zeolite-SR fertilizer composition. The measure application of N- Zeolite-SR fertilizer showed Inpari-13 variety is the varieties who’s more responsive plant growth compared with Ciherang variety. | |
| 5011 | 14828 | G1A012027 | PERBEDAAN JUMLAH PRODUKSI AIR MATA DAN SKOR OSDI ANTARA WANITA HAMIL DAN TIDAK HAMIL DI BKMIA KARTINI PERWOKERTO | Latar belakang: Sindrom mata kering merupakan gangguan pada lapisan air mata mata akibat jumlah produksi air mata yang kurang atau evaporasi air mata yang berlebihan. Kehamilan merupakan salah satu faktor resiko sindrom mata kering yang masih belum jelas. Metode pemeriksaan yang dapat dilakukan untuk mendiagnosis sindrom mata kering yaitu tes Schirmer I dan skoring OSDI. Tujuan: Mengetahui perbedaan jumlah produksi air mata dan skor OSDI antara wanita hamil dan tidak hamil di RS BKMIA Kartini Purwokerto. Metode: Penelitian ini merupakan penelitian analitik observasional dengan pendekatan cross-sectional. Sampel penelitian adalah wanita hamil dan tidak hamil di BKMIA Kartini Purwokerto. Pemilihan sampel dilakukan dengan teknik purposive sampling dengan jumlah total sampel 44 orang. Penelitian ini dilakukan pada 22 Februari – 27 Februari 2016 di BKMIA Kartini Purwokerto. Data dianalisi dengan menggunakan uji statistik Independent T Test dan Mann Whitney. Hasil: Analisis perbedaan jumlah produksi air mata wanita hamil dan tidak hamil yang diukur menggunakan tes Schirmer I menunjukkan hasil analisis dengan nilai p<0,05 (p=0,000). Analisis perbedaan skor OSDI wanita hamil dan tidak hamil menunjukkan hasil p>0,05 (p=0,120). Kesimpulan: Terdapat perbedaan rerata yang bermakna jumlah produksi air mata (tes Schirmer I) wanita hamil dan tidak hamil. Tidak terdapat perbedaan yang bermakna skor OSDI wanita hamil dan tidak hamil | Background: Dry eye syndrome is a disorder of the tear film due to tear deficiency or excessive evaporation. Pregnancy is one of a risk factor for dry eye syndrome that is still unclear. Examination methods that can be performed to diagnose dry eye syndrome are Schirmer test and scoring OSDI. Objective: To determine differences of tear production and OSDI score between pregnant and non-pregnant women at BKMIA Kartini Purwokerto. Method: This research was an analytical observational study with cross-sectional approach. Samples were pregnant and non-pregnant women at BKMIA Kartini Purwokerto. The sample selection was done by using purposive sampling with total sample 44 women. This research was conducted on 22 February to 27 February 2016 at BKMIA Kartini Purwokerto. Data was analyzed by Independent T test and Mann Whitney test. Result: Analysis the differences of tear production between pregnant and nonpregnant women were measured using Schirmer test I showed the result p<0.05 (p = 0.000) . Analysis the differences of OSDI scores between pregnant and non-pregnant women showed results p>0.05 (p = 0.120). Conclusion: There was significant difference of tear production (Schirmer test I) between pregnant and non-pregnant women. There was no significant difference of OSDI score between pregnant and non-pregnant women. | |
| 5012 | 14829 | A1M012056 | PERBAIKAN HIGIENITAS DAN SANITASI TERHADAP KARAKTERISTIK MUTU DALAM PENGOLAHAN GULA KELAPA DI INDUSTRI KECIL MENENGAH SARI BUMI KABUPATEN PURBALINGGA | Salah satu penyebab permasalahan mutu yang dihadapi oleh IKM (Industri Kecil Menengah) adalah kurangnya higienitas dan sanitasi. Penelitian ini bertujuan untuk: 1) Mengetahui pengaruh sosialisasi dan pendampingan sistem pengolahan gula kelapa yang baik terhadap kondisi higienitas dan sanitasi, 2) Mengetahui pengaruh sosialisasi dan pendampingan kondisi higienitas dan sanitasi terhadap karakteristik mutu produk gula kelapa. Penelitian dilaksanakan pada lingkungan IKM gula kelapa Sari Bumi di Desa Bojong, Kecamatan Mrebet, Purbalingga. Sosialisasi dan pendampingan sistem pengolahan gula kelapa yang baik terhadap kondisi higienitas dan sanitasi dilakukan dengan metode kaji tindak. Responden merupakan seluruh anggota dan mitra IKM Sari Bumi yang berjumlah 40 orang, sedangkan sosialisasi dan pendampingan kondisi higienitas dan sanitasi terhadap karakteristik mutu produk gula kelapa digunakan metode ekperimental dengan rancangan faktorial tersarang. Faktor yang dicoba adalah unit pengrajin (P) terdiri dari 2 sampel pengrajin gula kelapa kristal setengah jadi (P1 dan P3); 2 sampel pengrajin gula kelapa cetak (P4 dan P5); 1 sampel gula kelapa kristal yang telah dikeringkan IKM Sari Bumi (P2); waktu sampling gula kelapa (W) terdiri dari minggu awal (W2); minggu 4 (W4); minggu 6 (W6); minggu 8 (W8); minggu 10 (W10); minggu 12 (W12). Hasil penelitian menunjukkan bahwa kegiatan sosialisasi dan pendampingan higienitas dan sanitasi dapat meningkatkan pengawasan terhadap hewan pengerat/serangga, perbaikan layout produksi, perawatan prasarana penunjang, kebersihan pra pengolahan, pengadaan suplai air yang bersih dengan cukup baik (skor 3), namun belum dapat memperbaiki higiene pengrajin (skor 2,4). Kegiatan sosialisasi dan pendampingan higienitas dan sanitasi memperbaiki karakteristik mutu gula kelapa pada bahan yang tidak larut air, kadar air, kadar abu, gula reduksi, sukrosa, dan dapat menekan kontaminasi mikrobia. Kadar air, kadar abu, gula reduksi, serta sensori gula kelapa sudah memenuhi SNI 01-3743-1995, namun jumlah mikrobia masih melebihi batas SNI 7388:2009. | One of the causes of quality problems faced by Sari Bumi SME is the lack of hygiene and sanitation. This research aims: 1) To determine the effect of socialization and accompaniment good palm sugar processing systems to the hygiene and sanitation condition, 2) determine the effect of socialization and accompaniment of hygiene and sanitation conditions to the quality characteristics of coconut sugar. Socialization and accompaniment good palm sugar processing systems to the hygiene and sanitation condition conducted by the action research method. The respondents are all members and partners of Sari Bumi SME of 40 people, while socialization and accompaniment of hygiene and sanitation condition to the quality characteristics of coconut sugar used an experimental method with nested factorial design. Factors studied were craftsmen unit and the sampling time. The craftsmen unit consists of two craftsmen units semi-finished granule coconut sugar (P1 and P3), two craftsmen units of solidified coconut sugar (P4 and P5), and one craftsmen unit of granule coconut sugar that have been dried Sari Bumi SME (P2), while time of sampling consist of First Week (W2), Week 4 (W4) Week 6 (W6), Week 8 (W8), Week 10 (W10), and Week 12 (W12). The results showed that information dissemination and advocacy on hygiene and sanitation can improve its supervision of rodents / insects, improvement of production layout, maintenance infrastructures, cleanliness pre-processing, provision of water supply is clean with fairly good (score 3), but has not been able to improve hygiene craftsmen (score 2.4). Socialization and accompaniment hygiene and sanitation improve the quality characteristics of coconut sugar in water-insoluble materials, moisture content, ash content, reducing sugar, sucrose, and can reduce microbial contamination. Moisture content, ash content, reducing sugar, palm sugar and sensory already meet SNI 01-3743-1995, but the number of microbes still exceed the limit of SNI 7388: 2009. | |
| 5013 | 14830 | H1F011023 | Geologi dan Karakteristik Sistem Panasbumi Daerah Pintumas dan Sekitarnya Kecamatan Pantar Tengah Kabupaten Alor Nusa Tenggara Timur | Pulau Pantar, Nusa Tenggara Timur merupakan salahsatu daerah volkanik yang berpotensi sebagai sumber panasbumi. Maksud dari penelitian ini yaitu untuk melakukan pemetaan geologi, pemetaan alterasi dan penyelidikan geokimia terhadap manifestasi panasbumi berupa mata air panas dan tanah panas yang berada di daerah penelitian. Lokasi penelitian terletak pada titik koordinat Longitude/Latitude zona 49S 1240 8’ 7,908” BT - 1240 11’ 24,648” BT dan 80 24’ 9,108” LS - 80 28’ 30,144” LS dengan total luas daerah penelitian sebesar 48 km². Secara administratif wilayah pemetaan termasuk kedalam wilayah Kecamatan Pantar Tengah, Kabupaten Alor, Provinsi Nusa Tenggara Timur. Analisis yang digunakan untuk menentukan mineral alterasi adalah PIMA, sedangkan untuk data kimia air, gas dan tanah melalui analisis kandungan kimia yang terdapat dalam manifestasi tersebut. Geomorfologi daerah penelitian dibagi menjadi perbukitan dan daratan. Litologi daerah penelitian terdiri dari lava basalt, batugamping, breksi piroklastik, lava andesit dan tuff. Zona alterasi yang terjadi di daerah penelitian adalah argilik lanjut, dengan kumpulan mineral alunit, kaolinit, dikite. Alterasi ini terbentuk pada suhu antara 1200C – 2100C. Daerah penelitian memiliki manifestasi air panas, gas dan tanah panas. Air panas APS memiliki tipe air campuran klorida dan SO4, APB bertipe klorida, dan APAM, APT 1, APT 2 bertipe bikarbonat. Kelima air panas memiliki reservoir yang sama. APS dan APB merupakan zona upflow daerah penelitian. Menurut kandungan isotop Stabil δD dan δ18O, APS memiliki asal air fluida magmatik dan mata air lainnya (APB, APAM, APT 1, APT 2, ADS, ADM) memiliki asal air meteorik. Menurut hasil plotting pada diagram Na-K-Mg dan perhitungan geotermometer Na-K didapatkan temperatur reservoir yaitu berkisar antara 1600C – 163,550C. Berdasarkan hasil pengeplotan pada diagram yang dibuat oleh Hochstein dan Sudarman, maka dapat diketahui perkiraan kedalaman reservoir daerah penelitian yaitu ±520 m. Asal gas manifestasi GS 1 dan GS 2 merupakan kerak bumi, sedangkan untuk manifestasi gas KU merupakan magmatik. Sistem panas bumi daerah penelitian adalah sistem panasbumi konvektif bertemperatur tinggi dengan relief tinggi. | Pantar Island, Nusa Tenggara Timur is one of the region as a potential volcanic geothermal resources. The purpose of this study is to conduct geological mapping, alteration mapping and geochemical investigation of the geothermal manifestations such as hot springs and hot land are located in areas of research. The research location is located at coordinates Longitude / Latitude zone 49S 1240 8’ 7,908” BT - 1240 11’ 24,648” BT dan 80 24’ 9,108” LS - 80 28’ 30,144” LS with total research area of 48 km². Administratively mapping included into the area of Pantar Tengah District, Alor Regency, Nusa Tenggara Timur Province. The analysis used to determine the alteration minerals is PIMA, while for chemical data of water, gas and ground through the analysis of chemical constituents contained in the manifestation. Geomorphology study area was divided into the hills and the mainland. The lithology of the study area consists of lava basalt, limestone, pyroclastic breccia, lava andesite and tuff. Alteration zones that occur in the study area is advanced argillic, with a collection of mineral allunite, kaolinite, dickite. This alteration formed at temperatures between 1200C - 2100C. The research area has manifestations hot water, gas and heat soil. The hot water type APS has a Mixed Cl-SO4 Water, APB type chloride, and APAM, APT 1, APT 2 type bicarbonate. Fifth hot water have the same reservoir. APS and APB is an upflow zone of the study area. According to the content of δD and δ18O Stable isotopes, APS has fluid water of magmatic origin and other springs (APB, APAM, APT 1, APT 2, ADS, ADM) has the origin of meteoric water. According to a diagram plotting the Na-K-Mg and Na-K geotermometer calculations obtained reservoir temperature ranged between 1600C - 163,550C. Based on the results plotting on the diagram made by Hochstein and Sudarman, it can be seen an approximate depth of the reservoir area of research is ± 520 m. Originally gas manifestations of GS1 and GS2 is the continental crust, whereas for the manifestation gas KU of magmatic origin. Geothermal systems research area is the geothermal system of convective high temperature with high relief. | |
| 5014 | 14831 | F1F011053 | AN ANALYSIS OF SOCIAL CLASS-BASED LANGUAGE CHANGE OF UTTERANCES PRODUCED BY THE MAIN CHARACTERS IN WE’RE THE MILLERS MOVIE | Bahasa berubah dari waktu ke waktu. Permasalahan umum dari penelitian ini adalah perubahan bahasa disebabkan oleh beberapa faktor dan permasalahan utama dari penelitian ini adalah perubahan bahasa disebabkan oleh sosial kelas. Data dari penelitian ini adalah ujaran dari semua karakter di film We’re The Millers sebagai data populasi. Sedangkan, sample di ambil dari ujaran yang diucapkan oleh pemain utama di film. Jenis penelitian ini adalah kualitatif. Oleh karena itu, penelitian ini menggunakan metode deskriptif kualitatif. Penulis menggunakan beberapa langkah dalam menganalisis data, yaitu pengurangan data, penampilan data, dan penyimpulan data. Hasil dari analisa data perubahan bahasa yang diucapkan oleh tiga pemeran utama sebagian besar adalah social need (102). Kedua adalah fashion and random fluctuation (88). Terakhir adalah foreign bodies (2). Penulis juga menemukan bagaimana perubahan sosial kelas mempengaruhi ujaran dari para pemain utama. Hal itu terjadi ketika mereka berada di situasi yang berbeda. Mereka menggunakan bahasa kasar dan bersikap tidak sopan ketika mereka sedang bersama anggota The Millers.Namun sebaliknya, Mereka menggunakan bahasa yang baik dan bersikap sopan ketika mereka sedang bersama orang lain. Penelitian ini diharapkan akan bermanfaat di bidang akademik maupun bukan akademik. Mahasiswa secara akademik dapat menggunakan penelitian ini sebagai referansi dalam memajukan penelitian yang masih berkaitan. Sementara, untuk bukan akademik, penelitian ini akan bermanfaat untuk penulis naskah dalam membuat naskah film. | Language changes over time. The general concern of this research is the changes of language caused by several factors and the main concern of this research is the changes of language caused by social class. The data of this research were all characters’ utterances in We’re The Millers movie as the population. While, the samples were taken from the utterances uttered by the main characters in the movie. This kind of research was qualitative research. Therefore, this research used descriptive qualitative method. The researcher took some steps in analyzing data. The steps were data reduction, data display, and data summarization. The result of the data analyis of the language change produced by three main characters mostly was social need (102 data). The second was fashion and random fluctuation (88 data). The last was foreign bodies (2 data). The researcher also found how the change of social class influences the main characters’ utterances. It happens when they are in different situation. They use bad language and act rudely when they are around members of The Millers. On the other hand, they use good language and act politely when they are around other people. This research hopefully could be beneficial both academically and non academically. The students, academically, can use this research as references in conducting related further research. While, non academically, this research would be beneficial to the script writers in making movie script. | |
| 5015 | 14832 | A1L111021 | KAJIAN KOMPOSISI PUPUK MAJEMUK NP TERHADAP PERTUMBUHAN DAN SERAPAN N OLEH CABAI PADA ENTISOL | Penelitian ini bertujuan untuk mengetahui: 1) komposisi pupuk majemuk NP Zeolit Granul yang mempunyai efisiensi N tinggi. 2) pengaruh mandiri dan interaksi antara komposisi pupuk majemuk NP Zeolit Granul dengan jenis tanaman cabai terhadap pertumbuhan, efisiensi penggunaan unsur hara N dan hasil tanaman cabai pada tanah Entisol. Penelitian ini dilaksanakan di rumah kaca Fakultas Pertanian, Universitas Jenderal Soedirman, Grendeng, Purwokerto dan di Laboratorium Ilmu Tanah, Fakultas Pertanian, Universitas Jenderal Soedirman, Purwokerto. Penelitian ini berlangsung selama sembilan bulan dan dilaksanakan pada Maret 2015 sampai dengan Desember 2015. Penelitian ini menggunakan Rancangan Acak Kelompok Lengkap (RAKL), dengan 2 faktor dan 3 kali ulangan. Sebagai faktor pertama ialah perlakuan kombinasi pupuk NP Zeolit granul (pupuk N Zeolit granul : Batuan Fosfat Alam) yang terdiri dari enam taraf yaitu: tanpa pupuk (Ko), 1 : 1 (NP1), 1 : 1,5 (NP2), 1 : 2 (NP3), 1 : 2,5 (NP4), dan 1 : 3 paket perlakuan (NP5). Faktor kedua ialah jenis tanaman yang terdiri atas 2 taraf yaitu: K = jenis tanaman Krida dan D = jenis tanaman Dewata. Variabel yang diamati adalah tinggi tanaman, jumlah cabang, bobot segar tajuk, bobot kering tajuk, bobot segar akar, bobot kering akar, bobot segar buah total, pH-H2O, DHL, efisiensi serapan N, N- tersedia, N-total tanah, dan N jaringan tanaman. Hasil penelitian menunjukkan bahwa Penambahan BFA sebesar 320 gr - 960 gr meningkatkan efisiensi penggunaan N 12,5%-28,8%. Efisiensi penggunaan N tertinggi terdapat pada penambahan BFA sebesar 640 gr. Pemberian pupuk NP Zeolit menunjukkan peningkatan tinggi tanaman (33,03%), efisiensi penggunaan N (28,8%) dan bobot segar buah total panen ke-7 (18,5 gr). Pupuk NP3 atau pada penambahan 640 gr BFA merupakan pupuk terbaik dalam meningkatkan pertumbuhan, efisiensi penggunaan N dan hasil tanaman cabai. | The purpose oh this research are : 1) find out the composition of compound fertilizer NP Zeolie Granul that have a high N efficiency. 2) find out the independent effect and the interaction between the composition of compound fertilizer NP Zeolie Granul with kind of pepper plants on the growth, nutrient use efficiency of N and yield of pepper plants on Entisol. This research was conducted in the greenhouse Agriculture Faculty, General Sudirman University, Grendeng, Purwokerto and in the Soil Science Laboratory, Agriculture Faculty, General Sudirman University, Purwokerto. The study lasted nine months and was carried out in March 2015 until December 2015. The design of the experiment applied is the factorial Randomized Complete Blok Design (RCBD) which is 2 factor and repeated 3 times. As the first factor is a combination treatment of NP Zeolie Granul (N fertilizer granule zeolites: Rock Phosphate), which consists of six levels ie: without fertilizer (Ko), 1: 1 (NP1), 1: 1.5 (NP2), 1: 2 (NP3), 1: 2.5 (NP4), and 1: 3 treatment packages (NP5). The second factor is the type of plants consisting of two levels ie: K: Krida plant species and D: Dewata plant species The observed variables were plant height, number of branches, canopy fresh weight, shoot dry weight, root fresh weight, root dry weight, total weight of fresh fruit, pH-H2O, DHL, N uptake efficiency, available N, N-total ground, and N plant tissue. The results showed that BFA addition by 320 gr – 960 gr, increasing efficiency use of N between 12,5% - 28,8%. The highest efficiency use of N showed in the addition BFA by 640 gr. NP Zeolite granul increasing plant height (33.03%), efficiency use of N (28.8%) and the total weight of fresh fruit 7th harvest (18.5 g). NP3 fertilizer or the addition of 640 grams BFA is the best fertilizer in promoting growth, N use efficiency and yield of pepper plants. | |
| 5016 | 14833 | F1G012057 | Pesan Moral pada Novel De Winst Karya Afifah Afra | RINGKASAN Skripsi ini berjudul “Pesan Moral pada Novel De Winst Karya Afifah Afra”. Tujuan penelitian ini untuk mendeskripsikan pesan moral. Selain itu, sebelum mendeskripsikan pesan moral, peneliti terlebih dahulu mendeskripsikan plot, tokoh dan penokohan, setting dan tema yang terdapat pada novel De Winst Karya Afifah Afra. Penelitian ini menggunakan metode deskriptif kualitatif, dengan memfokuskan pada pesan moral yang terdapat pada novel De Winst karya Afifah Afra. Teknik pengumpulan data yang digunakan adalah membaca dan memahami isi novel, mencatat data penting yang berhubungan dengan fokus penelitian, mengklasifikasi data berdasarkan rumusan masalah. Selanjutnya dianalisis dengan teori strukturalisme. Hasil penelitian ini menjelaskan secara deskriptif pesan moral yang terdapat pada novel De Winst karya Afifah Afra. Sebelum menganalisis pesan moral, peneliti terlebih dahulu mendeskripsikan tema pada novel. Tema yang terdapat pada novel De Winst karya Afifah Afra adalah perjuangan buruh yang memperjuangkan haknya sebagai tenaga kerja, perjuangan warga pemilik lahan yang memperjuangkan harga sewa lahan yang pantas, dan perjuangan kaum pribumi memperjuangkan kemerdekaan. Kemudian peneliti menganalisis pesan moral yang terdapat pada novel De Winst karya Afifah Afra. Pesan moral dalam novel yaitu Manusia harus berani, Manusia harus peduli sesama dan Manusia harus teguh pendiriannya. | SUMMARY This research entitle "Pesan Moral pada Novel De Winst Karya Afifah Afra". The purpose of this research is to describe the moral value in the novel. Before describing the purpose, researcher described the plot, character and characterization, setting, and theme of De Winst Novel by Afifah Afra. This research used qualitative descriptive method that focus on moral value that exist in De Winst Novel by Afifah Afra. The technique of collecting the data were reading and understanding the novel, noting the important data that appropriate with the research objectives, and clarifying the data that were appropriate with the research questions. The next step, the data were analyzed by structuralism theory. The result of this research described the moral value in descriptive. Before analizing the moral value, the researcher described the theme in the novel first. The theme in De Winst novel by Afifah Afra was "the struggle of labor that fight of their rights as labor, the struggle of the owner of the land that prosecute the rent land price, and the struggle of native's freedom. The last, the researcher analyzed the moral value in the De Winst Novel by Afifah Afra. The moral value of the novel is, human must be brave, human must be aware of their circumstance. | |
| 5017 | 14834 | A1H011016 | ANALISIS KETERSEDIAAN AIR DAERAH ALIRAN SUNGAI (DAS) MARO KABUPATEN MERAUKE, PAPUA MENGGUNAKAN TOPMODEL PADA PROGRAM GRASS GIS 7.0.0 | Penggambaran kondisi DAS sangat penting dalam kajian perencanaan wilayah. Banyak biaya dan sumber daya manusia yang dibutuhkan jika DAS yang diamati memiliki area yang sangat luas dan terpencil. Metode TOPMODEL merupakan permodelan rainfall-runoff yang menawarkan simulasi hidrologi dengan syarat praktis tiga komponen, yaitu input yang meliputi curah hujan dan evapotranspirasi, indeks topografi yang diperoleh dari citra Shuttle Radar Topographic Mission (SRTM) dan parameter yang meliputi luas area DAS, debit air dalam tanah, transmisivitas, jarak dan kecepatan aliran sungai. Daerah penelitian mencakup seluruh DAS Maro, Kabupaten Merauke, Papua dengan periode waktu tahun 2005-2015. Komponen input, indeks topografi dan parameter diperoleh dari stasiun meteorologi Mopah, Merauke, citra SRTM EartExplorer.us.gov,dan studi pustaka beserta hasil penelitian terkait . Hasil simulasi menunjukan debit maksimum bulanan di tahun 2005-2014 dan harian di tahun 2015. Data debit simulasi dibuat analisis frekuensi untuk ditentukan hujan rancangan. distribusi yang cocok dengan data penelitian yaitu Log Pearson Type III. Hasil uji Kolmogorov-Smirnov menunjukkan kecocokan dimana Nilai Tabel > Nilai Hitung. Nilai debit periode ulang 1, 2, 5, 10, 25, 100, dan 200 tahun berturut-turut yaitu 3,28 x 108 m3/bulan; 10,83 x 108 m3/bulan; 16,33 x 108 m3/bulan; 20,15 x 108 m3/bulan; 25,13 x 108 m3/bulan; 28,93 x 108 m3/bulan; 32,78 x 108 m3/bulan; dan 36,74 x 108 m3/bulan. Data hujan dan debit selama 11 tahun dapat digunakan untuk menentukan analisis ketersediaan air pertanian. Analisis dilakukan dengan menghitung rata-rata curah hujan dan debit dari setiap bulan selama 11 tahun, hasilnya dapat digunakan sebagai acuan pola tanam untuk beberapa tahun ke depan. | The depiction of the watershed conditions is very important in the field of regional planning. Many costs and human resources are needed if the watershed that will be observed have a very wide area and secluded. TOPMODEL methods offers a simulation of hydrology with practically three components terms, the input that includes rainfall and evapotranspiration, the topography index obtained from the image of the Shuttle Radar Topographic Mission (SRTM) and parameters that covering the area of the watershed, the water discharge in the soil, transmissivity and distance and the flow rate of the river. The research area cover all of Maro watershed area, Merauke Regency, Papua with 2005 – 2015 of time periode. The input component, the topography index and parameter obtained from Mopah Meteorological station, Merauke, EarthExplorer.us.gov SRTM image, and literature review with the related research. Simulation results show the maximum monthly debit at 2005 – 2014 and daily debit at 2015. Frequency analysis are made from the rainfall data and debit simulation to determine rain layout. Distribution that fits with the data is Log Pearson Type III. Kolmogorov-Smirnov test results on the distribution of the selected show a match where Value Table > Calculate Values.Rainfall and debit value for repeated periode of 1, 2, 5, 10, 25, and 200 consecutive years is 3,28 x 108 m3/month; 10,83 x 108 m3/month; 16,33 x 108 m3/month; 20,15 x 108 m3/month; 25,13 x 108 m3/month; 28,93 x 108 m3/month; 32,78 x 108 m3/month; 36,74 x 108 m3/month. The rainfall and debit data for 11 years ahead can be used to determine analysis of agriculture water availabilitty. The analisys done with calculation of average rainfall and debit data for every month in 11 years, the results can be used for planting scedule references for several years ahead. | |
| 5018 | 14825 | F1G012027 | ABREVIASI BAHASA INDONESIA DALAM SURAT KABAR RADAR BANYUMAS | Penelitian ini berjudul “Abreviasi Bahasa Indonesia Dalam Surat Kabar Radar Banyumas”. Tujuan penelitian ini yaitu untuk mendeskripsikan jenis-jenis dan proses abreviasi bahasa Indonesia yang terdapat dalam surat kabar Radar Banyumas edisi 14 s.d. 20 Desember 2015. Bentuk penelitian ini adalah deskriptif kualitatif. Data dan sumber data yang digunakan dalam penelitian ini adalah bentuk abreviasi berupa singkatan, akronim, kontraksi, penggalan, dan lambang huruf yang ada di dalam surat kabar Radar Banyumas edisi 14 s.d. 20 Desember 2015. Metode pengumpulan data yang digunakan adalah metode simak dengan teknik dasar teknik sadap dan teknik lanjutannya yaitu teknik catat. Metode yang digunakan untuk menganalisis data yaitu metode padan dengan teknik dasar yaitu teknik pilah unsur penentu, sedangkan teknik lanjutannya yaitu teknik hubung banding menyamakan. Hasil analisis data pada penelitian ini disajikan secara informal. Hasil yang diperoleh dalam penelitian ini yaitu ditemukan lima jenis abreviasi antara lain singkatan, penggalan, akronim, kontraksi, dan lambang huruf dengan berbagai pola pembentukan abreviasi serta ditemukan juga bentuk lain abreviasi. Beragam proses abreviasi ditemukan dalam surat kabar Radar Banyumas. Proses abreviasi yang terjadi dari kelima jenis abreviasi tersebut yaitu dengan berbagai pola pembentukan yang sudah ada dalam bahasa Indonesia dan pola pembentukan yang baru. Secara umum, dari data yang diperoleh pola pembentukan singkatan yang paling sering digunakan pada surat kabar Radar Banyumas adalah singkatan yang terbentuk dengan pengekalan huruf pertama tiap komponen. Pola pembentukan penggalan yang sering muncul yaitu pengekalan tiga huruf pertama dari suatu kata. Pada akronim dan kontraksi pola pembentukan yang paling banyak ditemukan adalah pengekalan huruf dan berbagai suku kata yang sukar dirumuskan, sedangkan pola pembentukan lambang huruf yang banyak muncul yaitu lambang huruf yang terbentuk dari pengekalan huruf pertama dari komponen gabungan. Selain itu, ditemukan bentuk lain abreviasi dengan pola pembentukan penyingkatan atas kependekan yang lebih dominan dalam surat kabar Radar Banyumas. | This study entitled "Indonesian abbreviation In The Newspaper of Radar Banyumas". The purpose of this study is to describe the types and processes of Indonesian abbreviation which contained in the newspaper of Radar Banyumas in the 14th Edition of December 20, 2015. The forms of this study is descriptive qualitative. Data and sources used in this study is the form of the abbreviation, acronym, contraction, fragment, and the symbol which issued in Radar Banyumas in the 14th Edition of December 20, 2015. Data collection method used is refer to the basic techniques of tapping techniques and its subsequent is a notetaking technique. The method used to analyze data that is identity method with basic techniques, namely sorting technique decisive element, while the technique of sequel that appeals equalize circuit techniques. The results of data analysis in this study are presented informally. The results obtained in this research, there are five types of abbreviation, which are abbreviation, fragment, acronyms, contractions, and the epitome of letters with various patterns of abbreviation formation and also found other forms of abbreviation. Various processes abbreviation found in the newspaper of Radar Banyumas. The process that occured in the abbreviation of the five types of abbreviation that is by forming various patterns which already exist in the Indonesian language and the pattern formation of new ones. In general, from the data obtained on the pattern formation, one of the most common acronyms used in the newspaper of Radar Banyumas is an acronym formed by the first letters of each component perpetuation. Pattern formation of fragments that often arises is the perpetuation of the first three letters of a word. In the Acronyms and contractions, One of the most common pattern used is the perpetuation of letters and various syllables which are difficult to formulate, while the pattern formation of the letters that have appeared emblem is the symbol of the letter which formed from the first letter of the perpetuation of the combined components. In addition, there are other forms of abbreviation with the pattern formation of condensation on the abbreviation which more dominant in the newspaper of Radar Banyumas. | |
| 5019 | 14836 | A1C111001 | Analisis Biaya, Pendapatan, dan Nilai Tambah Usahatani Kopra di Kecamatan Somagede Kabupaten Banyumas | ABSTRAK Penelitian ini bertujuan untuk mengetahui : 1) besarnya biaya dan pendapatan usahatani kopra di Kecamatan Somagede, 2) rasio penerimaan dan biaya yang dikeluarkan dalam usahatani kopra di Kecamatan Somagede, 3) analisis volume produksi dan penerimaan pada tingkat Break Even Point periode produksi April sampai dengan Mei 2015 pada usahatani kopra di Kecamatan Somagede, 4) analisis pengaruh perubahan harga jual kopra dan bahan baku terhadap pendapatan usahatani kopra di Kecamatan Somagede, 5) besarnya nilai tambah dari usahatani kopra di Kecamatan Somagede. Penelitian ini dilaksanakan di Kecamatan Somagede Kabupaten Banyumas pada bulan April 2015 sampai dengan Mei 2015. Analisis data yang digunakan adalah analisis biaya dan pendapatan, analisis Revenue Cost Ratio (R/C), analisis Break Even Point (BEP), analisis sensitivitas dan analisis nilai tambah. Hasil penelitian menunjukkan usahatani kopra di Kecamatan Somagede merupakan kegiatan usahatani yang dilakukan secara turun temurun dan masih menggunakan peralatan tradisional. Kopra langsung dijual ke pengepul setempat dan pabrik minyak kelapa yang datang langsung ke tempat produksi.Analisis biaya, penerimaan dan pendapatan per periode bulan April 2015 menunjukkan bahwa rata-rata total biaya yang dikeluarkan sebesar Rp12.442.317,00, penerimaan yang diterima sebesar Rp19.747.932,00 dan pendapatan bersih yang diterima sebesar Rp 7.305.615,00. Produksi kopra yang dihasilkan oleh petani di Kecamatan Somagede dengan rata-rata tenaga kerja 5,43 HOK adalah 2.408,30 kg. Usahatani kopra layak dikembangkan karena nilai R/C Sebesar 1,59. BEP produksi sebesar 103,30 kg dengan penerimaan sebesar Rp693.111,00. Analisis sensitivitas pada perubahan tingkat biaya dan penerimaan menunjukkan bahwa perubahan pendapatan relatif stabil. Nilai tambah setelah diolah menjadi kopra sebesar Rp525,63. | ABSTRACT This study aims to understanding : 1) the amount of costs and income from copra farming in Somagede, 2) the ratio of revenues and expenses incurred from copra farming in Somagede, 3) analysis on production volumes and revenues at the Break Even Point level on April to Mei 2015 production period to the copra farming in Somagede, 4) analysis of the effect of changes in the price of copra and raw materials to the income of copra farming in Somagede, 5) the amount of the additional value from farming copra in Somagede. This study was implemented in the Somagede district of Banyumas in April 2015 to May 2015. The data analysis was the analysis of costs and revenues, the analysis of Revenue Cost Ratio (R / C), the analysis Break Even Point (BEP), sensitivity analysis and additional value analysis. The results showed that the Somagede copra farming is farming activities that carried out for generations and are still using traditional equipment. Copra directly sold to local collectors and oil mills who come directly to the production site. Analysis of costs, revenues and earnings per period from April 2015 shows that the average cost of Rp12.442.317,00, revenue of Rp19.747.932,00 and net income of Rp7.305.614,00. Production of copra produced by farmers in Somagede with an average of 5,43 HOK labors was 2.408,30 kg. Copra farming should be developed for the R / C amounted to 1,63. BEP production amounted to 103,30 kg with revenue of Rp693.111,00. Sensitivity analysis on changes in the level of costs and revenues shows that the changes of incomes are relatively stable. additional value when processed into copra is Rp525,63. | |
| 5020 | 14837 | H1F010044 | GEOLOGI DAN STUDI ALTERASI-MINERALISASI DAERAH CISARUA DAN SEKITARNYA, KECAMATAN NANGGUNG, KABUPATEN BOGOR, JAWA BARAT | Daerah penelitian terletak pada daerah Cisarua, Kecamatan Nanggung, Kabupaten Bogor, Jawa Barat, termasuk dalam wilayah IUP PT. Aneka Tambang (Tbk) site Gunung Pongkor. Daerah penelitian terdiri dari tiga satuan geomorfologi yaitu satuan perbukitan vulkanik berlereng sedang, satuan perbukitan vulkanik berlereng terjal, dan satuan perbukitan vulkanik berlereng sangat terjal. Daerah penelitian tersusun atas empat satuan litologi, dari tua ke muda yakni satuan breksi andesit, satuan breksi tuf, satuan tuf lapili, dan satuan lava andesit. Adanya proses tektonik menghasilkan struktur geologi berupa sesar mendatar kanan Ciparay, sesar mendatar kanan Cirabig, sesar mendatar kanan Cikaniki, dan sesar mendatar kiri Cisarua. Pada daerah penelitian terdapat tiga zona alterasi yaitu zona klorit zeolit epidot, zona klorit ilit monmorilonit, dan zona kaolin haloisit monmorilonit ilit. Pola arah urat pada daerah penelitian berarah baratlaut-tenggara. Mineral bijih yang dijumpai berupa pirit, sfalerit, kalkopirit, kalkosit, dan asantit. Berdasarkan data penelitian dan pembandingan dengan model yang sudah ada sebelumnya, tipe endapan pada daerah penelitian merupakan endapan epitermal sulfida rendah. | The research area is located in Cisarua, Nanggung District, Bogor Regency, West Java, this area is included to IUP PT Antam Tbk area site Gunung Pongkor. There are three morphological units in this area, they are moderately slope of volcanic hill unit, steep slope of volcanic hill unit, and extremely steep slope of volcanic hill unit. There are four lithological units in this area, they are andesite breccia unit, tuff breccia unit, lapili tuff unit, and andesite lava unit. The existence of tectonic process produced Ciparay right slip fault, Cirabig right slip fault, Cikaniki right slip fault, and Cisarua left slip fault. There are three zones of alteration: chlorite zeolite epidote zone, chlorite illite monmorilonite zone, and kaolinit halloysite monmorilonite illite zone. In the research area, vein orientation is northwest-southeast. Ore mineral which can be identified are pyrite, sphalerite, chalcopyrite, chalcocite, and acanthite. Base on the data and comparasion with existing model, the deposit of the research area is typical of low sulphidation epithermal deposit. |