Artikel Ilmiah : G1A012097 a.n. KHARISMA NAUFAL YUDANTONO
| NIM | G1A012097 |
|---|---|
| Namamhs | KHARISMA NAUFAL YUDANTONO |
| Judul Artikel | DETEKSI GEN APC PADA DAERAH EKSON 15 DARI JARINGAN DALAM FIKSATIF FORMALIN : Studi pada Tikus (Rattus norvegicus) Galur Wistar yang dipapar Asap Kretek |
| Abstrak (Bhs. Indonesia) | Latar belakang : Merokok telah menjadi gaya hidup bagi sebagian orang. Sebagian besar rokok yang dikonsumsi oleh orang Indonesia adalah rokok jenis kretek. Rokok secara umum mengandung 7000 bahan kimia yang sebagian besar merupakan bahan karsinogenik. Paparan bahan karsinogenik dari rokok dalam jangka waktu yang panjang dapat menyebabkan mutasi beberapa gen. Salah satu gen yang menjadi kunci dalam supresi tumor adalah gen APC. Mutasi gen APC ditemukan dalam 60% adenoma. Target mutasi pada gen APC adalah di daerah ekson 15, sekaligus merupakan ekson terbesar pada gen APC. Penelitian tentang deteksi gen APC pada daerah ekson 15 dianggap penting, untuk melengkapi studi tentang tikus (Rattus norvegicus) galur Wistar. Sediaan fiksatif formalin dipilih karena belum ada penelitian sebelumnya. Studi ini sekaligus dilakukan untuk menilai positivitas gen APC pada fiksatif formalin menggunakan metode PCR. Tujuan : Tujuan dari penelitian ini adalah untuk mendeteksi dan mengetahui positivitas gen APC di ekson 15 pada jaringan fiksatif formalin dengan metode PCR, diharapkan hasil yang didapat dapat melengkapi studi tentang tikus (Rattus norvegicus) galur Wistar yang dipapar asap kretek. Metode Penelitian : Penelitian ini menggunakan metode deskriptif dengan pendekatan potong lintang (cross sectional). Peneliti menggunakan jaringan fiksatif formalin tikus (Rattus norvegicus) Galur Wistar, berjumlah 20 sampel. Dilakukan dengan metode PCR menggunakan primer spesifik left 5’- TGCATCA TGGAAAGATACGTG -3’ dan right 5’- GTCTGGCTCCGGTAAGTGAG -3’ berukuran 276 pb. Hasil : Deteksi DNA gen APC ditemukan positif pada 4 dari 20 sampel. Kesimpulan : Gen APC dapat terdeteksi pada fiksatif formalin menggunakan metode PCR dan positivitasnya adalah 20%. |
| Abtrak (Bhs. Inggris) | Background : Smoking has become a lifestyle for some people. Most of the cigarettes consumed by the people of Indonesia are kretek cigarettes. Cigarettes generally contain 7,000 chemicals which are largely carcinogenic material. Exposure to carcinogenic substances from cigarettes in a long period of time can cause mutations in several genes. One gene as tumor suppressor is the APC gene. APC gene mutation was found in 60% of adenomas. Targeted mutation of the APC gene is in the region of exon 15 and it is the largest exon in the gene. Research on the detection of APC gene at exon 15 is considered as an important study and to complete a study on rats ( Rattus norvegicus ) Wistar strain. Preparations of formalin fixative are selected because no previous studies have been found. This study was performed to assess the positivity of the APC gene in formalin fixative using PCR methods. Goal : The purpose of this study was to detect and determine the positivity of APC gene in exon 15 of the formalin fixated tissue by PCR. The results obtained were expected to complement the study on rats ( Rattus norvegicus ) Wistar strain exposed to kretek smoke. Method : This research used a descriptive method with cross sectional approach. Researchers used a formalin fixated tissue of rats ( Rattus norvegicus ) Wistar strain with a total of 20 samples. Performed by PCR using specific primers 5' left TGCATCATGGAAAGATACGTG-3 ' and 5' right GTCTGGCTCCGGTAAGTGAG -3" size of 276 bp. Result : DNA detection of APC gene was found positive in 4 of 20 samples. Conclusion : APC gene can be detected in formalin fixated tissue using the PCR method and its positivity was 20 % . |
| Kata kunci | Deteksi APC, PCR, karsinogenesis, kanker kolorektal, Rattus norvegicus. |
| Pembimbing 1 | dr. Dody Novrial Sp.PA, M.Si.Med |
| Pembimbing 2 | Dr. Drs. Daniel Joko Wahyono, M.Biomed |
| Pembimbing 3 | |
| Tahun | 2016 |
| Jumlah Halaman | 12 |
| Tgl. Entri | 2016-04-28 07:19:07.101711 |