Artikelilmiahs

Menampilkan 18.781-18.800 dari 51.471 item.
#IdartikelilmiahNIMJudul ArtikelAbstrak (Bhs. Indonesia)Abtrak (Bhs. Inggris) 
  
1878122106E1A013310IMPLIKASI PRINSIP PRESIDENTIAL THRESHOLD TERHADAP PELAKSANAAN DEMOKRASI DI INDONESIAPenelitian ini berjudul “IMPLIKASI PRINSIP PRESIDENTIAL THRESHOLD TERHADAP PELAKSANAAN DEMOKRASI DI INDONESIA”. Penelitian ini bertujuan untuk mengetahui implikasi dari diterapkannya prinsip Presidential Threshold terhadap pelaksanaan demokrasi dalam sistem ketatanegaran Republik Indonesia. Penelitian ini menggunakan metode hukum secara yuridis-normatif, dengan spesifikasi penelitian deskriptif-analitis. Data yang disajikan secara secara sistematis dan rasional, dan analisis data dilakukan secara normatif.
Penyelenggaraan Pilpres di Indonesia Pasca Perubahan UUD NRI 1945 mengenal ketentuan Ambang Batas calon Presiden dan Wakil Presiden atau yang di istilahkan Presidential Threshold. Ketentuan ini digunakan sebagai prasyarat dalam pencalonan Presiden dan Wakil Presiden. Adapun pengaturannya dapat dilihat pada Pasal 222 UU No. 7 Tahun 2017 tentang Pemilihan Umum yang menegaskan bahwa pasangan calon Presiden dan Wakil Presiden hanya diusulkan oleh Partai Politik atau Gabungan Partai Politik peserta Pemilu yang memenuhi persyaratan, yakni memperoleh kursi minimal 20% (dua puluh persen) dari jumlah kursi DPR atau memperoleh 25% (dua puluh lima persen) suara sah nasional dalam Pemilu anggota DPR sebelumnya.
Dari hasil penelitian dapat diketahui bahwa prinsip Presidential Threshold seperti yang diatur dalam Undang-Undang Pemilihan Umum telah menimbulkan permasalahan baru dalam sistem ketatanegaraan Indonesia, khususnya dalam sistem pemilihan umum Presiden dan Wakil Presiden di Indonesia yang pada dasarnya bersifat demokratis. Dapat diketahui bahwa ambang batas pencapresan telah diterapkan dalam pemilihan umum Presiden dan Wakil Presiden pertama kali diterapkan pada tahun 2004 dan tetap digunakan sampai dengan pemilu pada tahun 2019.
Ketentuan Persentase ambang batas pada UU No.7 Tahun 2017 tentang Pemilihan Umum merupakan salah satu bentuk kebijakan hukum tebuka (Open Legal Policy) yang dibuat pemerintah yang tujuannya untuk menciptakan sistem pemerintahan presidensial dapat bekerja secara efektif di Indonesia. Dalam perkembangannya, Ketentuan Presidential Threshold tersebut memberikan diajukan permohonan pengujian (Judicial Review) karena dianggap menutup ruang demokrasi dalam mengajukan calon Presiden, terhadap Pasal 222 UU Pemilu tersebut dengan Pasal 6A UUD NRI 1945 ke Mahkamah Konstitusi (MK). Mahkamah Konstitusi pun mengeluarkan putusan-putusannya beberapa kali yang pada pokoknya menolak permohonan pemohon untuk menghapuskan ketentuan Presidential Threshold tersebut.
This research entitled "IMPLICATION PRINCIPLES OF PRESIDENTIAL THRESHOLD ON IMPLEMENTATION OF DEMOCRACY IN INDONESIA". This study aims to determine the implications of the implementation of the principle of Presidential Threshold on the implementation of democracy in the constitutional law system Republic of Indonesia. This research uses legal method in juridical-normative, with descriptive-analytical research specification. Data presented systematically and rationally, and data analysis is done normatively.
Implementation of Presidential Election in Indonesia Post-Amendment of the 1945 Constitution of the Republic of Indonesia recognizes the provisions of the threshold of Presidential and Vice Presidential Candidates or termed Presidential Threshold. This provision is used as a prerequisite in the nomination of the President and Vice President. The arrangement can be seen in Article 222 of Law no. 7 of 2017 concerning General Election which states that the candidate pair of President and Vice President shall only be proposed by Political Parties or Composite Political Parties participating in Election that fulfill the requirement of obtaining seats of at least 20% (twenty percent) of the total seats of Parliament or obtaining 25% twenty-five percent) of the national legitimate votes in the election of members of Parliament, previously.
From the research results it can be seen that the principle of Presidential Threshold as stipulated in the Law of General Election has caused new problems in the Indonesian state administration system, especially in the general election system of President and Vice President in Indonesia which is basically democratic. It is known that the imprinting threshold has been applied in the election of President and Vice President first applied in 2004 and remains in use until the elections in 2019.
Conditions The percentage of thresholds on Law No.7 Year 2017 on General Elections is one form of Open Legal Policy created by the government with the aim of creating a presidential government system working effectively in Indonesia. In its development, the Presidential Threshold Provision always creates a Judicial Review because it is considered to close the democratic space in submitting the Presidential candidate to Article 222 of the Election Law with Article 6A of the 1945 Constitution of the Republic of Indonesia to the Constitutional Court (MK). The Constitutional Court also issued its verdicts several times which in essence always refused the petitioner's request to abolish the provisions of the Presidential Threshold
1878222107H1C013030RANCANG BANGUN DAN ANALISA INVERTER MODIFIKASI SINUS SUMBER ARUS TIGA TINGKAT DENGAN KONTROL BERBASIS MIKROKONTROLERIndonesia merupakan negara yang cukup tinggi tingkat pertumbuhan penduduknya, sehingga mengakibatkan kebutuhan akan listrik pun semakin meningkat. Akan tetapi meningkatnya konsumsi energi listrik berkebalikan dengan ketersedian bahan bakar konvensional yang semakin menipis. Sehingga menuntut manusia agar dapat menggunakan energi alternatif seperti angin, tenaga matahari dan gelombang laut. Agar dapat menggunakan energi tersebut dibutuhkan alat pengubah listrik seperti inverter. Penggunaan inverter dalam dewasa ini semakin pesat seiring dengan berkembangnya sistem energi terbarukan yang dapat mengubah sumber tegangan DC seperti pada pembangkit tenaga surya ataupun baterai menjadi tegangan AC. Ide dasar dari sebuah inverter adalah mengatur keluaran sumber tegangan DC positif dan DC negatif agar bekerja menyuplai tegangan secara bergantian dengan bantuan penyaklaran. Komponen penyaklaran pada inverter tersebut dapat berupa komponen semikonduktor daya seperti MOSFET atau IGBT. Namun pada pengaplikasiannya, inverter dapat mngalami loses yang timbul akibat waktu perpindahan penyaklaran yang terlalu singkat sehingga dapat mengakibatkan keluaran yang kurang stabil.
Penelitian ini dilakukan dengan simulasi, rancang bangun dan eksperimen di laboratorium pada inverter sumber arus tiga tingkat dengan 4 saklar menggunakan kontrol modifikasi sinus yang sinyalnya akan dibangkitkan dengan mikrokontroler. Simulasi komputer dan hasil pengujian di laboratorium terhadap prototype dengan duty cycle 40% mampu menghasilkan output tegangan tiga level yang memiliki nilai harmonisa yang rendah. Pada penelitian ini menggunakan trafo step up dengan input tegangan menggunakan satu sumber ±24 VDC.
Indonesia is a country with quite high population growth that causes increase of electricity need. However, the increase of electricity consumption is contrary with the availability of fuel which is getting more diminish. It demands human to use alternative energy such as wind, solar energy, and sea wave. Electric converter such as inverter is needed to use that kind of energy. Nowadays, the use of inverter grows so fast along with development of renewable energy system which can change DC to AC voltage source as in solar power plant or battery. Basic idea of an inverter is to manage output of positive DC and negative DC voltage source so that it can supply voltage alternately with switching support. Switching component in inverter can be semiconductor component such as MOSFET or IGBT. However, in applicating it, inverter can encounter loses that appears because of too short switching displacement time that can cause less stable output.
This research is done with simulation, design, and laboratory experiment with four switches sine modified current source inverter three levels which its signal is raised by microcontroller. Computer simulation and laboratory test result to prototype with 40% duty cycle can produce three levels voltage output that has low value of harmonics. This research is using step up transformer with voltage input using one source ±24 VDC
1878322108C1B014091PENGARUH KREDIBILITAS SELEBRITI, KREDIBILITAS IKLAN, DAN ELECTRONIC WORD OF MOUTH TERHADAP NIAT BELI MELALUI SIKAP MEREK DAN IKLAN
(Studi pada Konsumen Bandung Makuta)
Penelitian ini dilakukan untuk mengetahui dan menganalisis pengaruh kredibilitas selebriti, kredibilitas iklan, dan electronic word of mouth terhadap niat beli melalui sikap pada merek dan iklan. Sampel dalam penelitian ini berjumlah 110 responden yang merupakan masyarakat di Bandung maupun di luar Bandung yang pernah melihat iklan Bandung Makuta di media sosial Instagram, menonton ulasan orang lain mengenai Bandung Makuta di Youtube, dan mengetahui selebriti Laudya Cynthia Bella. Metode pemilihan sampel yang dipakai dalam penelitian ini menggunakan metode purposive sampling. Kemudian, data dianalisis dengan menggunakan analisis jalur yang terdiri dari 3 sub-struktur. Hasil analisis sub-struktur pertama menunjukkan variabel kredibilitas selebriti dan kredibilitas iklan berpengaruh terhadap sikap pada iklan. Nilai koefisien determinasi sebesar 0,495. Artinya, sebanyak 49,5% pengaruh kredibilitas selebriti dan kredibilitas iklan terhadap sikap pada iklan. Hasil analisis pada sub-struktur kedua menunjukkan kredibilitas selebriti dan sikap pada iklan mempengaruhi sikap terhadap merek. Sedangkan, kredibilitas iklan dan EWOM tidak mempengaruhi sikap terhadap merek. Nilai koefisien determinasi sebesar 0,555. Artinya, sebesar 55,5% pengaruh kredibilitas selebriti dan sikap pada iklan mempengaruhi sikap konsumen pada merek. Hasil analisis sub-struktur ketiga menunjukkan bahwa sikap terhadap iklan dan sikap terhadap merek berpengaruh pada niat beli. Nilai koefisien determinasi sebesar 0,271. Artinya, sebesar 27,1% pengaruh sikap pada iklan dan merek mampu mempengaruhi niat beli. This study was conducted to identify and analyze the influence of celebrity credibility, ad credibility, and electronic word of mouth on purchase intention through attitudes towards brand and advertisement. The sample in this study is 110 respondents who are people in Bandung and outside Bandung who have seen ads Bandung Makuta on social media Instagram, watched other people's reviews about Bandung Makuta on Youtube, and know the celebrity Laudya Cynthia Bella. Purposive sampling method used in the determination of the sample. Then, the data were analyzed using path analysis consisting of 3 sub-structures. The results of the first sub-structure analysis show the credibility of the celebrity and the credibility ads affect the attitudes towards advertisement. The coefficient of determination value is 0.495. That is, as much as 49.5% influence the credibility of celebrities and the credibility ads on attitudes towards advertising. The results of the analysis on the second sub-structure show the credibility of celebrities and attitudes towards ads affecting attitudes toward brand. Meanwhile, the credibility of ads and EWOM doesn’t affect attitudes toward brand. The value of determination coefficient of 0,555. That is, as much as 55.5% influence of celebrity credibility and attitudes towards ads affect consumer attitudes towards brand. The results of the third sub-structure analysis show that attitudes toward advertising and attitudes toward brands have an effect on purchasing intentions. The coefficient of determination value is 0.271. That is, as much as 27.1% influence attitudes towards ads and brand are able to influence purchase intentions.
1878422182H1C013071RANCANG BANGUN DAN ANALISIS INVERTER SPWM SUMBER ARUS TIGA TINGKAT KAPASITAS 1 KW DENGAN KONTROL BERBASIS MIKROKONTROLLERInverter merupakan suatu rangkaian elektronika yang berfungsi untuk mengubah tegangan input DC menjadi tegangan output AC, dimana besar tegangan dan frekuensi output dapat diatur sesuai dengan keinginan dan kebutuhan. Berdasarkan sumbernya, inverter dibedakan menjadi dua macam, yaitu : inverter sumber tegangan (VSI = Voltage Source Inverter) dan inverter sumber arus (CSI = Current Source Inverter). Dua buah inverter tersebut memiliki perbedaan yang terletak pada konfigurasi rangkaian. Pada inverter sumber arus komponen dioda dihubungkan secara seri dengan komponen pensakelaran, sedangkan inverter sumber tegangan komponen dioda diubungkan secara paralel dengan komponen pensakelaran. CSI memiliki keunggulan dibandingkan dengan VSI yaitu mampu menghasilkan arus output dengan distorsi harmonik yang kecil. PWM (Pulse Width Modulation) merupakan sebuah cara mengubah atau memanipulasi lebar sinyal yang dinyatakan dengan lebar pulsa dalam satu periode, untuk mendapatkan tegangan rata-rata yang berbeda. Pembangkitan sinyal PWM dengan metode digital memiliki keunggulan yaitu unjuk kerja sistem yang bagus karena lebih tahan terhadap gangguan. Penelitian ini dilakukan dengan metode simulasi, rancang bangun dan pengujian di laboratorium pada inverter sumber arus tiga tingkat dengan 4 buah sakelar menggunakan kontrol SPWM yang sinyalnya dibangkitkan dengan pembangkit sinyal segitiga dan sinus serta dilengkapi dengan pengendali arus yang menggunakan mikrokontroler. Parameter yang diujikan berupa : gelombang keluaran pada sisi beban dan sisi arus PWM, gelombang pada sisi primer dan sekunder pada filter dan spektrum harmonik . Pada pembangkitan sumber arus DC digunakan dua buah belitan induktor pada sisi primer dan sekunder dengan polaritas yang berbeda. Pengujian ini dilakukan pada saat pengujian tanpa pengendali arus dengan sumber DC 24 V dan saat menggunakan pengendali arus dengan sumber DC 20 V.Inverter is an electronic circuit that serves to convert the input DC voltage into AC output voltage, where the magnitude of voltage and output frequency can be adjusted in accordance with the wishes and needs. Based on the source, the inverter is divided into two kinds, namely: voltage source inverter (VSI = Voltage Source Inverter) and current source inverter (CSI = Current Source Inverter). The two inverters have differences that lie in the circuit configuration. Inverter the diode component current source is connected in series with the switching component, while the inverter voltage source diode components are connected in parallel with switching components. CSI has advantages compared to VSI that is able to generate output currents with small harmonic distortion. PWM (Pulse Width Modulation) is a way of altering or manipulating signal width expressed by pulse width in one period, to obtain different mean voltages. The generation of PWM signals with digital methods has the advantage of a good system performance because it is more resistant to interference. This research is done by simulation method, design and testing in laboratory at inverter of current source of 3 level with 4 switches using SPWM control whose signal is generated with triangle and sinus signal generator and equipped with current controller using microcontroller. The tested parameters are: the output wave on the load side and the PWM current side, the waves on the primary and secondary sides of the filter and the harmonic spectrum. At the generation of DC current source two inductor windings are used on the primary and secondary sides with different polarities. This test is performed during the test without a current controller with a 24 V DC source and when using a current controller with a DC source of 20 V.
1878522183C1K014014The Interaction Effect of Job Control and Work Locus of Control on Employee's Well-being at Work.Tujuan dari penelitian ini adalah untuk mengkonfirmasi dan
mengintegrasikan dari Spector et.al (2002) dan Karasek (1969) yang
mempelajari pengaruh kontrol pekerjaan dan lokus kontrol kerja pada tingkat
kesejahteraan karyawan. Literatur dan penelitian terdahulu yang ada hanya
mempelajari dan berbicara tentang pengaruh baik kontrol pekerjaan maupun
locus kontrol kerja sebagai variabel independen terhadap kesejahteraan di
tempat kerja. Penelitian ini menggunakan lokus kontrol kerja sebagai variabel
pemoderasi hubungan kontrol kerja terhadap kesejahteraan di tempat kerja.
Sampel dari penelitian ini adalah 54 orang karyawan dari departemen
produksi PT. Mitra Lestari Abadi. Karyawan permanen adalah kriteria dari
metode purposive sampling penelitian ini. Data dihitung dan dianalisis
menggunakan IBM Statistical Package for Social Science (SPSS) versi 25.
Hasil penelitian ini menunjukkan bahwa (1) Kontrol kerja memiliki pengaruh
positif dan signifikan terhadap kesejahteraan di tempat kerja. (2) Lokus
kontrol kerja memoderasi pengaruh kontrol pekerjaan dan kesejahteraan di
tempat kerja.
The purpose of this research is to confirm and integrate the Spector et.al
(2002) and Karasek’s (1969) founding on the influence of job control and
work locus of control on the rate of the employees’ well-being. Mainstream
literatures are only talking about the influence of either job control or work
locus of control as independent variable to the well-being at work. This
research uses work locus of control as moderating variable of the job control
relationship and influence towards well-being at work. The sample of this
research are 54 persons of PT. Mitra Lestari Abadi’s producing department
employees. Permanent employees are the criteria of this research’s purposive
sampling method. Data were calculated and analysed using IBM Statistical
Package for Social Science (SPSS) version 25. The result of this research are
shows that (1) Job control has positive and significance influence towards
well-being at work. (2) Work locus of control moderate the effect of job
control and well-being at work.
1878625489E1A015229PROSES PENYIDIKAN TINDAK PIDANA BEGAL KENDARAAN BERMOTOR
(Studi Kasus di Polres Banyumas)
Marak terjadi untuk saat ini bahwa pencurian kendaraan bermotor dengan ancaman kekerasan oleh pelakunya yang didalam masyarakat lebih menyebutnya dengan kata “Begal”. Penyidikan adalah serangkaian tindakan penyidik dalam hal menurut cara yang diatur dalam undang-undang ini untuk mencari serta menumpulkan bukti yang terjadi guna menemukan tersangkanya. Dalam penyidikan perbuatan tindak pidana, tersangka yang menjadi objek pemeriksaan, harus dianggap tidak bersalah sesuai dengan prinsip hukum atau “asas praduga tak bersalah” sampai diperoleh putusan pengadilan yang berkekuatan hukum tetap. Seorang penyidik dalam hal pemeriksaan pendahuluan dalam tindak pidana pencurian dengan kekerasan atau “Begal” kendaraan bermotor harus memperhatikan mengenai hak-hak tersangka di dalam pemeriksaan.
Penelitian ini merupakan penelitian hukum empiris yang bersifat deskriptif. Jenis data yang digunakan yaitu data primer dan data sekunder. Teknik pengumpulan data yang digunakan yaitu studi kepustakaan, dan wawancara. Hasil dari penelitian ini menyebutkan bahwa pejabat penyidik di Polres Banyumas dalam pemeriksaan pendahuluan pada tingkat penyidikan sudah menerapkan atau mengedepankan asas praduga tak bersalah sesuai Penjelasan Umum butir 3c KUHAP.
Nowadays, there are lots of motor vehicle robbery with the threat of violence by the perpetrators which people call it as “Begal”. Investigation is a series of investigator’s actions in terms of the manner stipulated in this law to find and collect evidence that occurred to find the suspect. In investigating criminal acts, the suspect who is the object of the investigation must be considered innocent in accordance with the principles of law or “the principle of presumption of innocence" until a court decision that has permanent legal force is obtained. An investigator, in the case of a preliminary examination in a crime of motor vehicle robbery by violence or "Begal", must pay attention to the rights of the suspect in the examination.
This research is a descriptive empirical law research. The types of data used are primary and secondary data. The techniques of data collection are literature study and interview. The results of this study state that investigating officers at Banyumas Regional Police during the preliminary examination at the investigation level have applied or put forward the principle of presumption of innocence in accordance with the General Explanation point 3c of the Criminal Procedure Code.
1878722110B1J014089PENGARUH PEMBERIAN INOKULUM MIKORIZA VESIKULA ARBUSKULA (MVA) CAMPURAN TERHADAP KEMUNCULAN PENYAKIT BUSUK BATANG PADA TANAMAN JAGUNG (Zea mays)Jagung (Zea mays) merupakan salah satu tanaman penghasil karbohidrat yang penting di Indonesia. Penyakit busuk batang yang disebabkan oleh Fusarium moniliforme menyebabkan produksi jagung mengalami penurunan. Salah satu cara mengendalikan penyakit busuk batang yang ramah lingkungan adalah menggunakan agensia pengendali hayati. Agensia mengendalikan pengendali hayati yang dapat digunakan adalah mikoriza vesikula arbuskula (MVA). Metode penelitian yang digunakan adalah metode eksperimental dengan Rancangan Acak Lengkap. terdiri dari dua jenis perlakuan yang dikombinasikan 5 dosis MVA campuran (10g/tanaman, 15 g/tanaman, 20 g/tanaman, 25 g/tanaman, 30 g/tanaman) dan 2 waktu pemberian MVA yakni ketika biji ditanam dan bibit dipindahtanamkan. Parameter utama yang diamati meliputi masa inkubasi penyakit dan intensitas penyakit busuk batang dan parameter pendukung yaitu pH tanah, temperatur, kelembapan ruang, dan derajat infeksi. Hasil penelitian menunjukkan bahwa pemberian inokulum MVA campuran dengan dosis dan cara inokulasi yang berbeda belum mampu menurunkan intensitas penyakit busuk batang pada tanaman jagung namun dapat memperpanjang masa inkubasi penyakit busuk batang. Pemberian inokulum MVA dosis 15 gram yang diinokulasikan ketika biji dtanam dapat memperpanjang masa inkubasi penyakit busuk batang.Maize (Zea mays) is one of the most important crops in Indonesia as a source of carbohydrates. Stalk rot disease is caused by Fusarium moniliforme can reduce yield of corn. An environmental friendy way to reduce stalk rot disease is the use biological control agent. One of microorganisms which can be a biological control agent is Vesicular Arbuscular Mycorrhiza (VAM). This research use experimental method with a Completely Randomized Design (CRD). The experimental treatment consists of two types of treatment which combine 6 dosages of VAM inoculum mixture (0 g/plant, 10 g/plant, 15 g/plant, 20 g/plant, 25 g/plant, and 30 g/plant) and two inoculation method VAM is inoculated when seeds are planted and inoculation when the seedlings are replanted. The parameters was observed the incubation period of the disease and the intensity of stalk rot as the main parameted and the measurement of pH, temperature, room humidity, and the degree of infection as supporting parameters. The results of this research showed that the dosage and inoculation of VAM mixture is not able to reduce the emergence of stalk rot disease on maize but it was able to extend the incubation period of disease. The inoculation 15 g/plant given when it was planted from seeds should done has the longest incubation period of disease.
1878822111E1A014193PERAN MEDIA TELEVISI NASIONAL SEBAGAI UPAYA PENCEGAHAN TINDAK PIDANA NARKOTIKA DI INDONESIA Media massa adalah sebagai media komunikasi yang sangat strategis untuk memberikan informasi dan peristiwa hukum karena memiliki cakupan wilayah yang luas. Dalam politik kriminal, peran media massa sebagai upaya non-penal menjadi penting karena dapat mempengaruhi budaya masyarakat selain pencegahan tanpa hukuman dan sistem peradilan pidana. Media massa khususnya televisi, memiliki keistimewaan dengan tersedianya informasi secara audio dan visual dan memiliki jumlah penonton lebih besar dibandingkan dengan media lainnya seperti radio, koran, majalah, dan tabloid. Permasalahan yang akan dibahas adalah bagaimana peran media televisi dalam pencegahan tindak pidana narkotika di Indonesia dan apa yang menjadi penghambat dalam pemanfaatan media televisi dalam melakukan pencegahan tindak pidana narkotika.
Penelitian ini menggunakan metode penelitian yuridis normatif dengan pendekatan peraturan perundang-undangan dan pendekatan analitis. Sumber data yang digunakan dalam penelitian ini adalah data sekunder. Data yang diperoleh disajikan secara deskriptif dalam bentuk uraian yang disusun secara sistematis dan logis.
Berdasarkan hasil penelitian menunjukan bahwa peran yuridis Media Televisi Nasional Sebagai Upaya Pencegahan Tindak Pidana Narkotika di Indonesia adalah dengan melakukan pembatasan terhadap penayangan unsur-unsur penyalahgunaan narkotika kecuali untuk edukasi pencegahan dan rehabilitasi serta keterbatasan peraturan dan fungsi monitoring dan evaluasi menjadikan peran media bersifat pasif.
Mass media is a communication medium that is very strategic to provide information and legal events because it has a wide area coverage. In criminal policy, the role of the mass media as a non-penal effort is important because it can affect the culture of society other than prevention without punishment and the criminal justice system.Mass media especially television has the privilege of providing audio and visual information and has a larger audience than other media such as radio, newspapers, magazines and tabloids.The problem to be discussed is how the role of television media in the prevention of narcotics crime in Indonesia and what is a barrier in the utilization of television media to carry out prevention functions of narcotic crime.
This research uses normative juridical research method with approach of legislation and analytical approach. Source of data used in this research is secondary data. The data obtained are presented descriptively in the form of a systematic and logical description.
Based on the results of the study showed that the role of juridical Media national television as a Narcotics Crime prevention efforts in Indonesia is to do the restriction against the showing of the elements of abuse of narcotics except for preventive education and rehabilitation as well, the limitations of the rules and functioning of the monitoring and evaluation made the role of the medias television are passive to conduct education for prevention narcotics abuse in Indonesia.
1878922113B2A016002Pengembangan Metode Deteksi Human Rhinovirus dengan quantitative Reverse Transcription Polymerase Chain ReactionHuman rhinovirus merupakan penyebab utama penyakit pernapasan pada anak dan dewasa dan menyebabkan eksaserbasi asma hinga lebih dari 50% dan penyakit paru obstruksi kronik. Diagnosis HRV penting untuk tujuan epidemiologis, penegakan diagnosa dan pemberian terapi pengobata. qRT-PCR merupakan variasi teknik RT-PCR konvensional. Sebagian besar deteksi HRV menargetkan sekuen gen 5’UTR. Pengembangan metode deteksi HRV berbasis qRT-PCR penting dilakukan sehingga dapat dijadikan alternatif metode deteksi HRV yang lebih baik.
Tujuan penelitian adalah melakukan desain primer dan probe gen 5’UTR dan mengetahui sensitifitas dan spesifisitas pasangan primer dan probe tersebut. Rancangan penelitian yang digunakan berupa rancangan deskriptif dengan jenis studi uji potong lintang dan bentuk studi berupa uji laboratorium. Data sensitifitas dan spesifisitas yang diperoleh dianalisis secara deskriptif.
Hasil penelitian yaitu diperoleh sekuen forward primer: 5'GTGTTCTAGCCTGCGTGG3'; reverse primer : 5'CCTGAATGCGGCTAACCCTA3' dengan panjang amplikon 121pasang basa, sedangkan sekuen probe: TexasRed 5’-AGGGTGTGAAGAGCCCCGTG-3’. Sekuen pasangan primer dan probe tersebut memenuhi syarat untuk qRT-PCR. Hasil optimasi pasangan primer dan probe menunjukkan bahwa suhu annealing optimal untuk digunakan pada uji sensitifitas dan spesifisitas adalah 60ºC. Hasil uji Sensitifitas menunjukkan bahwa sekuen pasangan primer dan probe memiliki kemampuan deteksi terendah pada DNA konsentrasi 10-7 ng/µl, sedangkan hasil uji spesifisitas menunjukkan bahwa sekuen pasangan primer dan probe spesifik untuk HRV-A dan HRV-B.
Human rhinovirus is a major cause of respiratory illness in children and adults and causes exacerbation of asthma up to 50% and chronic obstructive pulmonary disease. Diagnosis of HRV is important for epidemiological purposes, diagnostic enforcement and provision of treatment therapy. qRT-PCR is a variation of conventional RT-PCR techniques. Most HRV detection targets the 5'UTR gene. Development of qRT-PCR based HRV detection method is important so that it can be a better alternative method of HRV detection.
The aim of the study was to design the primer and probe of 5'UTR gene and to know the sensitivity and specificity of the primer pair and the probe. The research design was descriptive with type of cross sectional study. The sensitivity and specificity data obtained were analyzed descriptively.
The result of research is obtained by primer forward sequence: 5'GTGTTCTAGCCTGCGTGG3 '; reverse primer: 5'CCTGAATGCGGCTAACCCTA3 'with an amplicon length of 121 base pair, while the probe sequence: TexasRed 5'-AGGGTGTGAAGAGCCCCGTG-3'. The sequence of primer and probe pairs is eligible for qRT-PCR. Optimization results of the primers pair and probe indicate that the optimal annealing temperature for use on the sensitivity and specificity test is 60ºC. The sensitivity test showed that the sequence of primer pair and probe had the lowest detection ability on DNA concentration of 10-7 ng / μl, whereas the specificity test result indicated that the sequence of primer pair and probe was specific for HRV-A and HRV-B.
1879022188H1F012019STUDI GEOLOGI, KUALITAS, DAN CADANGAN BATUBARA DAERAH KINTAPURA DAN SEKITARNYA, KINTAP, TANAH LAUT, KALIMANTAN SELATANDaerah penelitian secara administratif berada di daerah Kintapura dan sekitarnya, Kintap, Kabupaten Tanah Laut, Provinsi Kalimantan Selatan. Penelitian dilakukan untuk mengetahui tatanan geologi, kualitas dan jumlah cadangan batubara yang terdapat di daerah penelitian. Metode yang digunakan dalam penelitian untuk mengetahui tatanan geologi adalah mengambil data primer dengan pemetaan geologi dan studi literatur terhadap daerah penelitian. Untuk mendapatkan data kualitas batubara dilakukan analisis proksimat, dan untuk mendapatkan jumlah cadangan batubara dilakukan pengukuran langsung di lapangan dan perhitungan cadangan dengan metode sayatan penampang. Fisiografis daerah penelitian berada pada daerah dataran rendah dengan beberapa perbukitan bergelombang, jenis batuan dominan di daerah penelitian adalah jenis batuan sedimen dengan arah jurus dominan timur – barat dan kemiringan lapisan dominan 60o kearah selatan. Morfologi daerah penelitian dibagi menjadi tiga satuan. Satuan stratigrafi di daerah penelitian dibagi menjadi empat satuan litostratigrafi tidak resmi dari yang tertua sampai yang paling muda yaitu Satuan Batulempung yang disetarakan dengan Formasi Warukin Atas, Satuan Perselingan Batupasir – Batulempung Sisipan Batubara serta Satuan Perselingan Batupasir – Batulempung yang disetaarakan dengan Formasi Dahor, dan Satuan Endapan Aluvial yang disetarakan dengan Formasi Aluvial berumur recent. Struktur geologi pada daerah penelitian berupa kompresi yang mengakibatkan kemiringan lapisan batuan menunjam sampai 60o. Batubara di daerah penelitian dianalisis dengan metode analisis proksimat dan memiliki nilai kalori dalam basis data dmmf sebesar 10.702,62 Kal/g yang masuk pada peringkat batubara Bituminous A dalam Klasifikasi Peringkat Batubara ASTM. Lapisan batubara utama di daerah penelitian terdiri dari tiga lapisan batubara. Setelah dilakukan perhitungan dengan menggunakan metode penampang sayatan, didapatkan hasil cadangan batubaranya 16.888.970,6 m3.Administratively, the recearch area is located at Kintapura and surrounding areas, Kintap, Tanah Laut Region, South Kalimantan Province. The research conducted to find out about geological orders, quality, and quantity of reserved coal in the research area. Methods that used in the research to find out about geological ordes are acquiring primary data by doing geology mapping and study some literatures about the research area. The quality data of coal is acquired by proximate analysis. And to get the quantity of reserved coal, there are aquired by direct measurement in the research field and by calculating the amount of reserved coal with cross-section method. Phisiographically, the research area is located at low plain relief with some wavy hills, the dominant rock type that found in research area is sedimentary rock type that have strike direction dominantly from east to west with dip of layer dominantly 60o that directed to south. Morfology of research area divided into three units. Stratigraphy units of research area devided into four unofficial lithostratigraphic units from the oldest to the most recent units, which is Claystone Unit that interpreted as part of Upper-Warukin Formation, Interspace of Sandstone and Claystone with Coal Implied Unit and Interspace of Sandstone and Claystone Unit that interpreted as part of Dahor Formation, lastly, Aluvium Deposition Unit that interpreted as part of Aluvial Formation that recently deposited. The geological structure in the research area is compression force that formed the rock layers dip to be 60o. Coal from research area has been analysed using proximate analysis and shown the calorific value (on dmmf basis data) of coal is 10.702,62 Ccal/g that graded as Bituminous A on Coal Grade Classification by ASTM. The main coal layers of research area have three layer. After conducted the calculating of reserved coal with cross-section method, it shows the amount of reserved coal in research area are 16.888.970,6 m3.
1879122093G1G014021Perbandingan Pengaruh Antara Paparan Photodynamic Therapy (PDT) Menggunakan Erythrosine dan Paparan Metronidazol terhadap Viabilitas Bakteri Porphyromonas gingivalisPeriodontitis merupakan penyakit inflamasi jaringan periodontal yang disebabkan oleh bakteri periodontopatogenik seperti Porphyromonas gingivalis. Terapi penyakit periodontitis adalah melakukan Scaling dan Root Planing (SRP) serta dilanjutkan dengan terapi adjuvan berupa pemberian antibiotik, salah satunya adalah metronidazol. Photodynamic Therapy (PDT) merupakan terapi adjuvan alternatif metronidazol yang memerlukan paparan sinar dan photosensitizer sebagai agen pengaktivasi Reactive Oxygen Species (ROS) untuk membunuh sel bakteri. Salah satu bahan yang dapat digunakan sebagai photosensitizer adalah erythrosine. Penelitian ini bertujuan untuk membandingkan efek antibakteri paparan PDT menggunakan photosensitizer erythrosine dan paparan metronidazol dalam mereduksi viabilitas bakteri Porphyromonas gingivalis. Jenis penelitian ini adalah penelitian eksperimental in vitro dengan rancangan Posttest-only control group design. Penelitian ini menggunakan 25 sampel yang terbagi ke dalam 5 kelompok sampel, yaitu Perlakuan I (PDT menggunakan erythrosine), Perlakuan II (metronidazol), Kontrol I (PDT tanpa erythrosine), Kontrol II (erythrosine), dan Kontrol III (akuades). Viabilitas bakteri Porphyromonas gingivalis ditentukan berdasarkan penghitungan jumlah koloni bakteri setelah masing-masing sampel dilakukan percobaan. Rata-rata jumlah koloni bakteri yang tumbuh pada Perlakuan I (3,6 x 103 CFU/mL) lebih sedikit dibandingkan rata-rata koloni bakteri Perlakuan II (25,4 x 103 CFU/mL). Analisis statistik menggunakan uji One-way ANOVA menunjukkan adanya perbedaan bermakna (p<0,05) antara seluruh kelompok. Uji Post-hoc LSD menunjukkan adanya perbedaan bermakna (p<0,05) antara kelompok Perlakuan I dengan Perlakuan II dan ketiga kelompok kontrol serta antara Perlakuan II dengan Kontrol I dan Kontrol III. Paparan PDT menggunakan erythosine memiliki efek antibakteri yang lebih baik jika dibandingkan dengan paparan metronidazol dalam mereduksi viabilitas Porphyromonas gingivalis.Periodontitis is a periodontal tissue inflammatory disease caused by periodontopathogenic bacteria such as Porphyromonas gingivalis. Therapy of periodontitis is Scaling and Root Planing (SRP) and continued with antibiotics adjuvant therapy, for example metronidazole. Photodynamic Therapy (PDT) is an alternative adjuvant therapy of metronidazole that requires light exposure and photosensitizer as activator agent of Reactive Oxygen Species (ROS) to kill bacterial cells. Material that can be used as photosensitizer is erythrosine. This study aimed to compare the antibacterial effects of PDT exposure using erythrosine and metronidazole exposure in reducing viability of Porphyromonas gingivalis. This type of research was experimental in vitro with posttest-only control group design. This study used 25 samples divided into 5 groups, namely Treatment I (PDT using erythrosine), Treatment II (metronidazole), Control I (PDT without erythrosine), Control II (erythrosine), and Control III (aquadest). The viability of Porphyromonas gingivalis was determined by the calculation of bacterial colonies after each group exposed. The average number of bacterial colonies in the Treatment I (3.6 x 103 CFU/mL) was less than the average of the Treatment II colonies (25.4 x 103 CFU/mL). Statistical analysis using One-way ANOVA test showed a significant difference (p <0.05) in all groups. Post-hoc LSD test showed significant differences (p <0.05) between the Treatment I, Treatment II, and the three control groups and also between Treatment II, Control I, and Control III. PDT exposure using erythosine has better antibacterial effect compared with metronidazole exposure in reducing Porphyromonas gingivalis viability.
1879222115C1C013048Analisis Reaksi Pasar Disekitar Tanggal Pelaksanaan Rapat Umum Pemegang Saham Tahunan (RUPST) Emiten Syariah di Indonesia Berdasarkan Jumlah Kapitalisasi Pasar. Penelitian ini manganalisis reaksi pasar atas informasi yang diungkapkan dalam Rapat Umum Pemegang Saham Tahunan (RUPST). Tujuan penelitian ini adalah untuk secara empiris menguji terjadinya reaksi pasar atas peristiwa RUPST dan mengetahui perbedaan abnormal return berdasarkan tingkat kapitalisasi pasar pada perusahaan syariah di Indonesia. Populasi dalam penelitian ini perusahaan yang melakukan Corporate event RUPST dan sahamya terdaftar dalam Jakarta Islamic Index (JII) dan Indonesia Sharia Stock Index (ISSI) selama periode 2015-2017. Jumlah sampel yang dipilih dalam penelitian ini adalah 40 emiten. Penelitian ini menngunakan metode purposive sampling. Sampel dipilih berdasarkan kategori nilai kapitalisasi pasar yang memiliki return dinamis dan selalu melakukan corporate event RUPST tahun 2015-2017. Penelitian ini mengestimasi abnormal return dengan menggunakan Capital Asset Pricing Model (CAPM) sebagai return ekspektasi minimun untuk memperoleh abnormal return. Alat Analisa yang digunakan untuk menguji hipotesis adalah SPSS 24. Penelitian ini melakukan uji beda non parametrik karena data yang tidak terdistribusi normal. Hasil penelitian menunjukkan bahwa Tidak terjadi reaksi pasar yang signifikan di sekitar tanggal pelaksanaan RUPST dan Tidak terdapat perbedaan rata-rata abnormal return antara perusahaan yang memiliki jumlah kapitalisasi pasar tinggi dengan perusahaan yang memiliki jumlah kapitaisasi pasar rendah.This study analyzes the market reaction to the information disclose in the Annual General Meeting of Shareholders (AGM). The purpose of this research is to empirically investigate market reaction to AGM event and to know the difference of abnormal return based on market capitalization rate in syariah company in Indonesia. The population in this study company conducting Corporate Event AGM and its shares are listed in the Jakarta Islamic Index (JII) and Indonesia Sharia Stock Index (ISSI) during the period 2015-2017. The number of samples in this study are 40 samples. This research uses purposive sampling method. The sample is based on the category of market capitalization value which has dynamic return and always conducts corporate event of AGM in 2015-2017. This study estimates the abnormal return by using Capital Asset Pricing Model (CAPM) as the minimum expectation return to obtain abnormal return. This Reasearch using non parametric test. The results of this study indicate that corporate events AGMS produce Abnormal Return, but do not show a significant market reaction. . Similarly, there is no significant abnormal return difference based on the market capitalization rate.
1879322116C1A014072Analisis Faktor-Faktor Yang Memengaruhi Neraca Perdagangan Indonesia Dengan TiongkokPenelitian ini berjudul “Analisis Faktor-Faktor yang Memengaruhi Neraca Perdagangan Indonesia dengan Tiongkok”. Tujuan dari penelitian ini adalah untuk mengetahui faktor-faktor makroekonomi yang mempengaruhi keseimbangan neraca perdagangan antara Indonesia dengan Tiongkok, serta untuk mengalisis faktor apakah yang paling mempengaruhi neraca perdagangan antara Indonesia dengan Tiongkok.
Data yang digunakan dalam penelitian ini bersifat kuantitatif dan menggunakan data sekunder. Penelitian ini juga menggunakan data yang dikumpulkan dari waktu ke waktu atau time series dengan periode waktu tahun 1997-2016. Metode yang digunakan dalam penelitian ini untuk mengetahui faktor yang pengaruh variabel independen terhadap variabel dependen menggunakan metode analisis metode analisis linear berganda dengan menggunakan eviews.
Hasil penelitian ini menunjukkan bahwa Kurs, Inflasi dan PDB memiliki pengaruh dalam keseimbangan neraca perdagangan antara Indonesia dengan Tiongkok. Kurs rupiah terhadap dollar amerika berpengaruh negatif dan tidak signifikan terhadap neraca perdagangan antara Indonesia dengan Tiongkok, Inflasi berpengaruh terhadap neraca perdagangan antara Indonesia dengan Tiongkok, PDB Indonesia berpengaruh negatif dan signifikan terhadap neraca perdagangan antara Indonesia dengan Tiongkok.Variabel yang paling besar pengaruhnya terhadap neraca perdagangan antara Indonesia dengan Tiongkok adalah inflasi.
Implikasi dari penelitian ini adalah diharapkan pemerintah mampu membuat keadaan neraca perdagangan yang seimbang kearah surplus dengan cara menjaga kestabilan perekonomian Indonesia.

This research entitled "Analysis of Factors Affecting Trade Balance Indonesia and China". The purpose of this study is to determine the macroeconomic factors that affect the balance of trade between Indonesia and China, as well as to analyze what factors that most affect the trade balance between Indonesia and China.
The data used in this study is quantitative and secondary data. This research also use time series with the period of 1997-2016. The method used in this research to know the factors that influence independent variables to the dependent variable using the method of analysis of multiple linear analysis using eviews.
The results show that Exchange Rate, Inflation and GDP have an influence in balance of trade balance between Indonesia and China. The rupiah exchange rate against the US dollar has a negative and insignificant effect on the trade balance between Indonesia and China. Inflation has a negative and insignificant effect on the trade balance between Indonesia and China. Indonesia's GDP has a negative and significant effect on the trade balance between Indonesia and China. the effect on the trade balance between Indonesia and China is inflation.
The implication of this research is that the government is expected to be able to make a balanced trade balance situation towards the surplus by maintaining the stability of Indonesian economy.
1879422114C1K014038The Effect of Electronic Word-Of-Mouth in Social Media toward Consumer Purchase Decision with Brand Image as Moderating Variable (Case Study: Etude House Korean Beauty Product)Munculnya internet dapat memungkinkan pengguna untuk berkomunikasi dengan jaringan mereka yang ada melalui media sosial. Dalam media sosial, pengguna dapat bertukar informasi dan mendiskusikan pendapat dan pengalaman mereka tentang produk atau jasa layanan secara online pada platform media sosial mereka dengan rekan-rekan mereka, yang mengacu pada orang-orang yang sudah mereka kenal seperti teman dan kenalan. Komunikasi semacam ini disebut dengan electronic word-of-mouth (e-WOM) di mana informasi dapat menyebar lebih cepat dan secara efektif mempengaruhi pengambilan keputusan pembelian konsumen. Cara baru e-WOM ini memiliki potensi untuk berdampak lebih besar pada konsumen. Oleh karena itu, tujuan dari penelitian ini adalah untuk mengetahui pengaruh e-WOM (termasuk quality dan quantity e-WOM serta sender’s expertise) di media sosial pada keputusan pembelian konsumen yang dimoderasi oleh citra merek. Metodologi penelitian yang digunakan untuk penelitian ini adalah studi kasus dengan metode penelitian survei. Teknik convenience sampling yang berasal dari teknik non-probability sampling digunakan untuk pemilihan sampel. Sampel dari penelitian ini adalah 175, dari orang-orang yang telah membeli dan menggunakan produk Etude House. Software statistik SPSS dan AMOS digunakan untuk menganalisis data. Temuan di bidang ini akan membantu Etude House dan pemasar lain untuk menjangkau potensial pelanggan dan menyelaraskan upaya pemasaran mereka dengan cara yang efisien dengan memperhatikan kebijakan pemasaran tentang eWOM. Keterbatasan penelitian adalah beberapa responden tidak membaca dan menjawab pertanyaan dengan jelas dan membuatnya tidak mewakili persepsi yang tepat.The emergence of internet has made it possible for users to communicate with their existing networks through social media. On social media, users enable to exchange information and discuss their opinions and experiences about products or services through online on their social media platform with their peers, which refers to people who they already know such as friends and acquaintances. This kind of communication is called as electronic word-of-mouth (e-WOM) where the information can be spread faster and effectively influent consumer purchase decision making. This new way of e-WOM has the potential for greater impact on consumers. Therefore, the aim of this research is to know the effect of e-WOM (including quality and quantity of e-WOM as well as sender’s expertise) in social media on consumers’ purchase decisions moderated by brand image. The research methodology used for this study is a case study with survey research method. Convenience sampling technique derived from non-probability sampling techniques are used for sample selection. The sample of this research is 175, from people who have purchased and used Etude House product. Statistical software SPSS and AMOS is used to analyze the data. The findings in this area will help Etude House and other marketers to reach out its potential customers and align their marketing effort in efficient way by pay attention on the marketing policies about eWOM. The limitations of the research is some respondents not read and answer the question clearly and made it not represent their exact perception.
1879522117P2CB14029PENGARUH EFIKASI DIRI, KEPRIBADIAN PROAKTIF DAN MOTIVASI TERHADAP PENERAPAN PELATIHAN PADA STAF PDAM TIRTA WIJAYA CILACAPPenelitian ini bertujuan untuk mengalisis apakah efikasi diri, kepribadian proaktif dan motivasi terhadap penerapan pelatihan berpengaruh terhadap penerapan pelatihan pada staf PDAM Tirta Wijaya Cilacap. Penelitian ini menggunakan 61 staf PDAM Tirta Wijaya sebagai sampel dengan menggunakan teknik simple radom sampling dengan rumus slovin. Teknik analisis data menggunakan analisis regresi linier berganda yang dioperasikan melalui program SPSS. Hasil penelitian menunjukkan bahwa: (1) Efikasi diri berpengaruh positif terhadap penerapan pelatihan. Artinya, semakin baik efikasi dengan kepribadian proaktif dan motivasi terhadap penerapan pelatihan maka akan meningkatkan penerapan hasil pelatihan. (2) Kepribadian proaktif berpengaruh positif terhadap penerapan pelatihan. Artinya, kepribadian proaktif yang semakin baik akan meningkatkan penerapan hasil pelatihan. (3) Motivasi terhadap penerapan pelatihan berpengaruh positif terhadap penerapan pelatihan. Artinya, motivasi terhadap penerapan pelatihan yang semakin baik akan meningkatkan penerapan hasil pelatihan. Dari hasil penelitian, dapat disimpulkan bahwa efikasi diri, kepribadian proaktif dan motivasi terhadap penerapan hasil pelatihan berpengaruh positif terhadap penerapan pelatihan.This study aims to analyze between self efficacy, proactive personality, and transfer motivation have a effect on training transfer at PDAM Tirta Wijaya Cilacap Staff. This research using sample 61 staff at PDAM Tirta Wijaya Cilacap with simple random sampling technique with the slovin formula. Data analyzer technique use multiple linear regression analysis which operated through SPSS Program. The result showed that: (1) Self efficacy has a positive influence to training transfer. That is, if the self efficacy are fit with proactive personality and transfer motivation, that’s will increase training transfer. (2) Proactive personality has a positive influence to training transfer. That is, if the proactive personality is more better that’s will increase training transfer. (3) Transfer Motivation has a positive influence to training transfer. That is, if the transfer motivation is more better that’s will increase training transfer. From the result of analysis, it can be concluded that self efficacy, proactive personality and transfer motivation have a positive effect on training transfer
1879622118C1K014006THE INFLUENCE OF FOOD & BEVERAGE QUALITY, SERVICE QUALITY, PLACE, AND PERCEIVED PRICE TO CUSTOMER SATISFACTION AND REPURCHASE INTENTION (An Emperical Study of Level Up Purwokerto)Penelitian ini berjudul '' Pengaruh Kualitas Makanan dan Minuman, Kualitas Pelayanan, Tempat, dan Persepsi Harga Terhadap Kepuasan Konsumen dan Minat Pembelian Kembali (Studi Empiris di Level Up Purwokerto) ". Jenis penelitian ini adalah studi kasus dengan metode survey menggunakan kuisioner sebagai alat pengumpulan data. Penelitian dilakukan di are Purwokerto.
Ada banyak jenis usaha kuliner, seperti kafe, restoran, foodstreet, foodcourt, dll. Tapi salah satu yang paling populer di masyarakat sekarang adalah kafe dan restoran. Salah satu kafe dan resto baru yang baru saja ditemukan di Purwokerto adalah Level Up. Sebagai pendatang baru, Level Up memiliki konsep unik, tempat, makanan dan minuman, dan juga pelayanan yang dapat menarik orang dewasa dan anak muda di Purwokerto untuk mengunjungi Level Up. Tapi, ada penurunan pelanggan yang mengunjungi Level Up setelah setahun berdiri dan masalah yang dihadapi oleh Level Up menjadi fenomena bisnis. Berdasarkan masalah di atas, penelitian ini dilakukan untuk menganalisis kualitas makanan dan minuman, kualitas layanan, tempat, dan harga yang dirasakan untuk kepuasan pelanggan dan minat pembelian kembali. .
Responden dalam penelitian ini adalah 165 responden yang berasal dari konsumen di Purwokerto yang telah dikunjungi Level Up Purwokerto. Penelitian ini menggunakan SEM (Structural Equation Model) sebagai alat analisis teknik. Perangkat lunak statistik SPSS digunakan untuk menganalisis data. Hasil pengujian hipotesis menggunakan T-test adalah sebagai berikut: (1) Kualitas makanan dan minuman berpengaruh positif terhadap kepuasan pelanggan. (2) Kualitas layanan berpengaruh positif terhadap kepuasan pelanggan. (3) Tempat memiliki pengaruh positif tetapi tidak signifikan terhadap kepuasan pelanggan. (4) Harga yang dirasakan memiliki efek positif terhadap kepuasan pelanggan. (5) Kepuasan pelanggan memiliki efek positif pada niat pembelian kembali.
This research entitled ’’ THE INFLUENCE OF FOOD & BEVERAGE QUALITY, SERVICE QUALITY, PLACE, AND PERCEIVED PRICE TO CUSTOMER SATISFACTION AND REPURCHASE INTENTION (An Emperical Study of Level Up Purwokerto)”. This type of the research research is case study with survey method by using questionnaire as a tool of data collection. The study was conducted in Purwokerto area.
There are many various type of culinary business, such as cafe, restaurant, foodstreet, foodcourt, etc. But one of the most popular in the society now is cafe and restaurant. One of the new cafe and resto that had been just found in Purwokerto is Level Up. As a new arrival, Level Up have a unique concept, place, foods and beverages, and also the services that can attract young adult in Purwokerto to visit Level Up. But, there was a decrease in the customers who visited Level Up after a year of standing and the problem that faced by Level Up become a business phenomenon. Based on the problems above, this research was conducted to analyze the food and beverage quality, service quality, place, and perceived price to customer satisfaction and repurchase intention.
Respondents of this research are 165 respondents came from consumers in Purwokerto who have been visited Level Up Purwokerto. This research uses SEM (Structural Equation Model) as analysis tools technique. Statistical software SPSS is used to analyze the data. The result of hypothesis testing using T-test is in the following: (1) Food and beverage quality has positive influence on customer satisfaction. (2) Service quality has positive influence on customer satisfaction. (3) Place has no significant influence on customer satisfaction. (4) Perceived price has a positive influence on customer satisfaction. (5) Customer satisfaction has a positive influence on repurchase intention.
1879722119D1E014054PENGGUNAAN FERMEHERBAFIT ENKAPSULASI DALAM PAKAN TERHADAP SEL DARAH PUTIH DAN TOTAL PROTEIN PLASMA PADA AYAM BROILERPenelitian ini berjudul “Penggunaan Fermeherbafit Enkapsulasi dalam Pakan terhadap Sel Darah Putih dan Total Protein Plasma pada Ayam Broiler”. Pelaksanaan penelitian mulai tanggal 28 September sampai dengan tanggal 2 November 2017 di Selo Arum Farm, Desa Karangrau, Kecamatan Sokaraja, Kabupaten Banyumas, Jawa Tengah; Laboratorium Sumber Daya Tanah, Fakultas Pertanian Universitas Jenderal Soedirman; dan Laboratorium Kesehatan Hewan, Sekolah Vokasi Universitas Gadjah Mada. Penelitian ini bertujuan untuk mengevaluasi efek penggunaan fermeherbafit enkapsulasi dalam pakan terhadap jumlah sel darah putih dan total protein plasma ayam broiler. Materi yang digunakan pada penelitian ini adalah 80 ekor DOC ayam broiler strain Multi Breeder (MB) 202 Platinum yang dipelihara sampai umur 35 hari. Percobaan dilakukan dengan metode eksperimental in vivo dan menggunakan Rancangan Acak Lengkap (RAL). Rancangan terdiri dari 5 perlakuan dan setiap perlakuan diulang sebanyak 4 kali dengan masing-masing ulangan terdiri dari 4 ekor ayam. Perlakuan terdiri dari R0 = pakan basal/kontrol; R1 = penggunaan 1,5% fermeherbafit nonenkapsulasi, R2 = penggunaan 1,5% fermeherbafit enkapsulasi, R3 = penggunaan 3,0% fermeherbafit enkapsulasi, dan R4 = penggunaan 4,5% fermeherbafit enkapsulasi dalam pakan. Hasil analisis variansi menunjukkan bahwa penggunaan fermeherbafit enkapsulasi dalam pakan berpengaruh tidak nyata (P>0,05) terhadap jumlah sel darah putih dan total protein plasma. Dapat disimpulkan bahwa Penggunaan fermeherbafit enkapsulasi dalam ransum ayam broiler menghasilkan jumlah sel darah putih dan total protein plasma ayam broiler yang relatif sama (stabil).The title of this study was "Effects of Using Fermeherbafit Encapsulation in Feed Towards White Blood Cell and Total Plasma Proteins on Broiler Chicken". The study was conducted from 28th September to 2nd November 2017 at Selo Arum Farm, Karangrau Village, Sokaraja Sub-district, Banyumas Regency, Central Java; Soil Resource Laboratory, Faculty of Agriculture, Jenderal Soedirman University; and Animal Health Laboratory, Vocational School of Gadjah Mada University. The study was aimed to evaluate the effects of using fermeherbafit encapsulation in feed towards White Blood Cell and Total Plasma Proteins on Broiler Chicken. The used materials in this research were 80 DOC broiler chickens strain Multi Breeder (MB) 202 Platinum which are maintained until the age of 35 days. Experiments were performed with in vivo experimental methods and used Completely Randomized Design (CRD). The design consisted of 5 treatments and each treatment was repeated 4 times with each replication contained 4 chickens. The treatment consisted of R0 = basal/control feed; R1 = feed contained of 1,5% fermeherbafit non-encapsulation, R2 = feed contained of 1,5% fermeherbafit encapsulation R3 = feed contained of 3,0% fermeherbafit encapsulation, and R4 = feed contained of of 4,5% fermeherbafit encapsulation. The result of variance analysis showed that the use of fermeherbafit encapsulation in feed had an unstable (P> 0,05) effect on white blood cell and total plasma protein. It can be concluded that the use of fermeherbafit encapsulation in broiler rations produces white blood cell count and total broiler plasma protein is relatively stable (stable).
1879822185C1C014105Faktor-Faktor yang Memengaruhi Penggunaan Informasi Akuntansi Pada UKM Sektor Restoran di PurwokertoPenelitian ini bertujuan untuk menganalisis dan menggambarkan hubungan skala usaha, umur usaha, pendidikan manajer, pelatihan akuntansi dan masa memimpin manajer terhadap penggunaan informasi akuntansi pada UKM, khususnya sektor restoran. Populasi dalam penelitian ini adalah seluruh UKM sektor restoran di Purwokerto. Penelitian ini menggunakan teknik purposive sampling dengan menentukan beberapa kriteria untuk dijadikan sampel. Sampel yang diperoleh dalam penelitian ini sebanyak 51 responden. Teknik pengumpulan data dengan teknik survei dengan penyebaran kuesioner dan teknik analisis data dalam penelitian ini menggunakan teknik analisis regresi berganda dengan bantuan software SPSS. Hasil penelitian ini menyimpulkan bahwa penggunaan informasi pada UKM, khususnya pada sektor restoran dipengaruhi oleh empat faktor yaitu : skala usaha, umur usaha, pendidikan manajer dan masa memimpin manajer. Pelatihan akuntansi tidak berpengaruh terhadap penggunaan informasi akuntansi.This research aims to analyze and describe the relation of business scale, age of business, manager’s education, accounting training and lead time manager to the use of accounting information on SMEs, especially the restaurant sector. The population in this study is all restaurant sector SMEs in Purwokerto. This research uses purposive sampling technique by determining some criteria to be sampled. Samples obtained in this research were 51 respondents. Data collection techniques with survey techniques with questionnaires distribution and data analysis techniques in this study using multiple regression analysis techniques with the help of SPSS software. The results of this research conclude that the use of accounting information of SMEs, especially in the restaurant sector, is influenced by four factors, namely: business scale, age of business, manager’s education and lead time manager. The accounting training has no effect to the use of accounting information on SMEs.
1879922121E1A114005PEMUTUSAN HUBUNGAN KERJA (PHK)
PADA PT. FREEPORT INDONESIA
(Studi Pada Putusan Nomor 431 K/PDT. Sus-PHI/2017)
Penelitian ini bersumber pada putusan Mahkamah Agung Nomor 431/Pdt.Sus-PHI/2017 yang menguatkan putusan Pengadilan Hubungan Industrial Nomor 276/Pdt.Sus-PHI/2016/PN.Jkt.Pst mengenai perkara pemutusan hubungan kerja (PHK) pada PT. Freeport Indonesia.
Penelitian ini menggunakan metode penelitian yuridis normatif. Pendekatan penelitian menggunakan pendekatan undang-undang dan analisis. Spesifikasi penelitian yang digunakan adalah deskriptif. Sumber bahan hukum yang digunakan merupakan bahan hukum primer dan bahan hukum sekunder dengan metode pengajian data dalam bentuk teks naratif dan disusun secara sistematis.
Berdasarkan hasil penelitian dan pembahasan dalam penelitian ini diketahui bahwa pertimbangan hukum hakim Mahkamah Agung yang menguatkan putusan Pengadilan Hubungan Industrial telah menyatakan pemutusan hubungan kerja yang dilakukan oleh PT.Freeport Indonesia terhadap pekerjanya harus dinyatakan batal demi hukum, karena pemutusan hubungan kerja dilakukan sebelum memperoleh penetapan dari lembaga penyelesaian perselisihan hubungan industrial yang telah sesuai dengan ketentuan Pasal 155 ayat (1) Undang-Undang Nomor 13 Tahun 2003 tentang Ketenagakerjaan.Hakim juga telah memperhitungkan kompensasi, dimana Termohon Kasasi berhak atas uang pesangon, uang penghargaan masa kerja, uang penggantian hak, THR 2016, Bonus Vacation dan upah proses, sehingga telah sesuai dan telah menerapkan Pasal 156 Undang-Undang Nomor 13 Tahun 2003 tentang Ketenagakerjaan.
This research comes from Supreme Court Decision Number 431/Pdt.Sus-PHI/2017 which strengthen Decision of Industrial Relations Court Number 276/Pdt.Sus-PHI/2016/PN.Jkt.Pst regarding termination of employment (FLE) at Freeport Indonesia Company.
This research uses normative juridical research method. The research approach uses the approach of law and analysis. The research specification used is descriptive. Sources of legal materials used are primary legal materials and secondary legal materials with methods of studying data in the form of narrative texts and arranged systematically.
Based on the results of research and discussion in this study it is known that the legal considerations of the Supreme Court judges that strengthenthe decision of the Industrial Relations Court has stated that the termination of employment by Freeport Indonesia Company to its workers must be declared null and void, because the termination of employment is done before obtaining the determination of industrial dispute settlement institution which is in accordance with the provisions of Article 155 paragraph (1) of Law Number 13 Year 2003 concerning Manpower. The Judge has also calculated the compensation, in which the Cassation Defendant is entitled to severance pay, rewards of employment, compensation money, THR 2016, Bonus Vacation and process wage, so it has been appropriate and has applied Article 156 of Law Number 13 Year 2003 concerning Manpower.
1880022190H1D014008PENGARUH BEBAN SIKLIK TERHADAP KAPASITAS DUKUNG TANAH PASIR YANG DIPERKUAT DENGAN ANYAMAN BAN KARETKerusakan pada jalan raya dapat diakibatkan karena adanya beban kendaraan yang terlalu berlebihan atau kapasitas dukung tanahnya yang memang kurang baik. Dalam dunia konstruksi, geogrid merupakan bahan yang biasa digunakan untuk meningkatkan daya dukung tanah. Penggunaan anyaman karet ban bekas diharapkan dapat menjadi bahan alternatif pengganti geogrid. Penelitian dilakukan di laboratorium menggunakan pemodelan, yang terdiri dari kotak pengujian dan anyaman karet ban bekas. Dimensi kotak pengujian yaitu 100 cm x 100 cm x 80 cm dengan ketinggian tanah pada saat pengujian 50 cm. Anyaman karet ban bekas yang digunakan memiliki ketebalan 2 mm dengan lebar 3 cm, panjang helai anyaman 100 cm, dan jarak antar helai anyaman 10 cm. Anyaman ini ditimbun 10 cm dari atas permukaan tanah. Variasi yang digunakan pada penelitian ini yaitu berupa persen beban siklik yang didapatkan dari uji beban statis pada tanah pasir tanpa perkuatan, diantaranya 20%, 40%, 60%, dan 80% dengan penumbukan menggunakan 5% energi proctor. Uji yang dilakukan antara lain pengujian karakteristik tanah, uji proctor, dan pengujian kapasitas dukung tanah. Setelah pengujian selesai, didapatkan beberapa hasil sebagai jawaban atas tujuan yang ingin dicapai. Hasil dari pengujian didapat beban maksimum pada beban siklik 20% sebesar 380,656 kg, 40% sebesar 545,607 kg, 60% sebesar 602,705 kg, dan 80% sebesar 697,869 kg. Itu berarti semakin besar beban siklik yang diberikan pada tanah pasir, semakin besar pula kapasitas dukung tanah pasir. Kesimpulannya adalah beban siklik yang diberikan lebih cenderung bersifat memadatkan. Dan jika dibandingkan dengan tanah pasir tanpa perkuatan, penggunaan anyaman karet ban bekas dapat meningkatkan kapasitas dukung.Damage in the highway can be caused by the excessive load of vehicles or the capacity of the soil is not good support. In the world of construction, geogrid is a material commonly used to increase the carrying capacity of the soil. The use of waste rubber tires is expected to be an alternative substance replacement geogrid. This research was conducted in the laboratory using modeling, which consisted of a test box and waste rubber tire. The dimensions of the test box are 100 cm x 100 cm x 80 cm with a soil height at the test time is 50 cm. Waste rubber tire used has a thickness of 2 mm with a width of 3 cm, the length of strands webbing 100 cm, and the distance between the strands of webbing 10 cm. This plaited is buried 10
cm above the ground. The variation used in this research is in the form of percent cyclic load obtained from static load test on sand soil without reinforcement, such as 20%, 40%, 60%, and 80% by using 5% proctor energy. Tests conducted include soil characteristics test, proctor test, and soil capacity testing. After the test is finished, some results are obtained in response to the goals to be achieved. The results of the test obtained the maximum load on 20% cyclic load is 380.656 kg, 40% is 545.607 kg, 60% is 602.705 kg, and 80% is 697.869 kg. That means, more greater of the cyclic load given to the sand, more greater the soil support capacity. The conclusion is that the cyclical load given is more likely to be compact. And when compared to the sand without reinforcement, the use of waste rubber tires can increase the support capacity.