Update Artikelilmiah: 22113

ASRYADIN

NIM

Judul Artikel

Abstrak (Bhs. Indonesia)

Human rhinovirus merupakan penyebab utama penyakit pernapasan pada anak dan dewasa dan menyebabkan eksaserbasi asma hinga lebih dari 50% dan penyakit paru obstruksi kronik. Diagnosis HRV penting untuk tujuan epidemiologis, penegakan diagnosa dan pemberian terapi pengobata. qRT-PCR merupakan variasi teknik RT-PCR konvensional. Sebagian besar deteksi HRV menargetkan sekuen gen 5’UTR. Pengembangan metode deteksi HRV berbasis qRT-PCR penting dilakukan sehingga dapat dijadikan alternatif metode deteksi HRV yang lebih baik.
      Tujuan penelitian adalah melakukan desain primer dan probe gen 5’UTR dan mengetahui sensitifitas dan spesifisitas pasangan primer dan probe tersebut. Rancangan penelitian yang digunakan berupa rancangan deskriptif dengan jenis studi uji potong lintang dan bentuk studi berupa uji laboratorium. Data sensitifitas dan spesifisitas yang diperoleh dianalisis secara deskriptif. 
      Hasil penelitian yaitu diperoleh sekuen forward primer: 5'GTGTTCTAGCCTGCGTGG3'; reverse primer  :  5'CCTGAATGCGGCTAACCCTA3' dengan panjang amplikon 121pasang basa, sedangkan sekuen probe: TexasRed 5’-AGGGTGTGAAGAGCCCCGTG-3’. Sekuen pasangan primer dan probe tersebut memenuhi syarat untuk qRT-PCR. Hasil optimasi pasangan primer dan probe menunjukkan bahwa suhu annealing optimal untuk digunakan pada uji sensitifitas dan spesifisitas adalah 60ºC. Hasil uji Sensitifitas menunjukkan bahwa sekuen pasangan primer dan probe memiliki kemampuan deteksi terendah pada DNA konsentrasi 10-7 ng/µl, sedangkan hasil uji spesifisitas menunjukkan bahwa sekuen pasangan primer dan probe spesifik untuk HRV-A dan HRV-B.

Abtrak (Bhs. Inggris)

Human rhinovirus is a major cause of respiratory illness in children and adults and causes exacerbation of asthma up to 50% and chronic obstructive pulmonary disease. Diagnosis of HRV is important for epidemiological purposes, diagnostic enforcement and provision of treatment therapy. qRT-PCR is a variation of conventional RT-PCR techniques. Most HRV detection targets the 5'UTR gene. Development of qRT-PCR based HRV detection method is important so that it can be a better alternative method of HRV detection.
      The aim of the study was to design the primer and probe of 5'UTR gene and to know the sensitivity and specificity of the primer pair and the probe. The research design was descriptive with type of cross sectional study. The sensitivity and specificity data obtained were analyzed descriptively.
      The result of research is obtained by primer forward sequence: 5'GTGTTCTAGCCTGCGTGG3 '; reverse primer: 5'CCTGAATGCGGCTAACCCTA3 'with an amplicon length of 121 base pair, while the probe sequence: TexasRed 5'-AGGGTGTGAAGAGCCCCGTG-3'. The sequence of primer and probe pairs is eligible for qRT-PCR. Optimization results of the primers pair and probe indicate that the optimal annealing temperature for use on the sensitivity and specificity test is 60ºC. The sensitivity test showed that the sequence of primer pair and probe had the lowest detection ability on DNA concentration of 10-7 ng / μl, whereas the specificity test result indicated that the sequence of primer pair and probe was specific for HRV-A and HRV-B.

Kata kunci

Pembimbing 1

Pembimbing 2

Pembimbing 3

Tahun

Jumlah Halaman