Artikel Ilmiah : B2A015006 a.n. RIZAL ADITYA HERMAWAN

Kembali Update Delete

NIMB2A015006
NamamhsRIZAL ADITYA HERMAWAN
Judul ArtikelKONTAMINAN Staphylococcus aureus DAN DETEKSI GEN PENYANDI STAPHYLOCOCCAL ENTEROTOKSIN A (SEA) PADA SUSU SAPI
Abstrak (Bhs. Indonesia)Abstrak
Produk peternakan seperti susu mempunyai nilai gizi yang sangat tinggi. Nilai gizinya yang tinggi menyebabkan susu menjadi media pertumbuhan mikroorganisme. Salah satu bakteri patogen yang umum susu sapi antara lain Staphylococcus aureus. Konsumsi makanan maupun minuman yang mengandung bakteri S. aureus dapat mengakibatkan keracunan makanan. S. aureus dapat menghasilkan berbagai macam enterotoksin tetapi dari kasus wabah keracunan yang pernah terjadi, Staphylococcal Enterotoksin A (SEA) adalah yang paling sering ditemukan. Penelitian ini bertujuan untuk mendeteksi adanya kontaminasi S. aureus dan keberadaan gen penyandi SEA pada susu sapi siap konsumsi. Sampel yang digunakan dalam penelitian diambil dari tempat kedai penjualan susu sapi siap konsumsi di seputaran Kota Kediri. Metode penelitian meliputi identifikasi dan penghitungan jumlah S. aureus serta amplifikasi gen penyandi SEA menggunakan forward primer TCATTGCCCTAACGTTGACA dan reverse primer GCCATAAATTGATCGGCACT dengan produk PCR sepanjang 432 bp. Berdasarkan hasil penelitian, sebanyak 5 isolat dari 25 sampel susu sapi terkontaminasi S. aureus dan gen penyandi SEA tidak terdeteksi pada semua isolat S. aureus tersebut. Meskipun S. aureus yang berhasil diidentifikasi tidak membawa gen SEA, tetapi masih ada potensi bakteri ini menyandi gen enterotoksin yang lain sehingga perlu dilakukan penelitian lanjutan untuk mendeteksi gen enterotoksin S. aureus selain gen SEA.

Kata Kunci : Staphylococcus aureus, Gen penyandi Staphylococcal Enterotoksin A (SEA), Susu Sapi.
Abtrak (Bhs. Inggris)Abstract
Livestock products such as milk have very high nutritional value. Its high nutritional value causes milk to become a good medium for growth of microorganisms. One of the common pathogenic bacteria in cow's milk is Staphylococcus aureus. Consumption of food and beverages that contain S. aureus can lead to food poisoning. S. aureus is able produce various types of enterotoxins, but from cases of food poisoning outbreaks that have occurred, Staphylococcal Enterotoxin A (SEA) was the most frequently found. This study aimed to detect the presence of S. aureus contamination and SEA-encoding gene in ready-to-consume cow's milk. Samples used in the study were taken from the shop which sold ready-to-consume cow's milk in Kediri City. Research methods included identification and counting of the number of S. aureus and amplification of SEA-encoding gene using forward primer TCATTGCCCTAACGTTGACA and reverse primer GCCATAAATTGATCGGCACT with PCR products of 432 bp. Based on the results of the study, 5 out of 25 samples of cow's milk were contaminated with S. aureus and SEA encoding genes were not detected in all S. aureus isolates. Although all S. aureus isolates that have been identified did not carry the SEA gene, but there is still the potential for this bacteria to encode other enterotoxin genes so that further research is needed to detect other S. aureus enterotoxin genes.
Key Words : Staphylococcus aureus, Staphylococcal Enterotoksin A (SEA) Coding gene, Cow’s milk
Kata kunciStaphylococcus aureus, Gen penyandi Staphylococcal Enterotoksin A (SEA), Susu Sapi
Pembimbing 1Dr. Hendro Pramono, M.S
Pembimbing 2Dr. Daniel Joko Wahyono, M.Biomed
Pembimbing 3
Tahun2019
Jumlah Halaman6
Tgl. Entri2019-08-28 21:23:58.005715
Cetak Bukti Unggah
© Universitas Jenderal Soedirman 2026 All rights reserved.